Transcript: Mouse NM_130452.1

Mus musculus butyrobetaine (gamma), 2-oxoglutarate dioxygenase 1 (gamma-butyrobetaine hydroxylase) (Bbox1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Bbox1 (170442)
Length:
1642
CDS:
94..1257

Additional Resources:

NCBI RefSeq record:
NM_130452.1
NBCI Gene record:
Bbox1 (170442)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_130452.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076418 CCCTGCAATCATATTCAATAT pLKO.1 1402 3UTR 100% 13.200 9.240 N Bbox1 n/a
2 TRCN0000076420 CCAATGACCATTACAGTGAAT pLKO.1 329 CDS 100% 4.950 3.465 N Bbox1 n/a
3 TRCN0000076422 GCAACCAGAGATACAGTCTTT pLKO.1 973 CDS 100% 4.950 3.465 N Bbox1 n/a
4 TRCN0000076419 CCATCGAAAGAGTTCAGCCTT pLKO.1 1001 CDS 100% 2.640 1.848 N Bbox1 n/a
5 TRCN0000076421 TGTGCAATCTAAACACAAGAT pLKO.1 903 CDS 100% 4.950 2.970 N Bbox1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_130452.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07237 pDONR223 100% 86.4% 89.1% None (many diffs) n/a
2 ccsbBroad304_07237 pLX_304 0% 86.4% 89.1% V5 (many diffs) n/a
3 TRCN0000467300 ATTTACCCCAGACATTCGTTGTGC pLX_317 36.8% 86.4% 89.1% V5 (many diffs) n/a
Download CSV