Transcript: Mouse NM_130870.1

Mus musculus keratin associated protein 19-2 (Krtap19-2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Krtap19-2 (170651)
Length:
605
CDS:
15..440

Additional Resources:

NCBI RefSeq record:
NM_130870.1
NBCI Gene record:
Krtap19-2 (170651)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_130870.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257569 TATGGAGGCTTTGGAGGCTTT pLKO_005 153 CDS 100% 4.050 2.835 N Krtap19-2 n/a
2 TRCN0000244012 GGCTTTGGAGGCTATGGATAT pLKO_005 339 CDS 100% 10.800 6.480 N KRTAP19-1 n/a
3 TRCN0000257720 GGCTTTGGAGGCTATGGATAT pLKO_005 339 CDS 100% 10.800 6.480 N Krtap19-2 n/a
4 TRCN0000251980 TTCTCCAGTTTCTACTGAAAT pLKO_005 423 CDS 100% 13.200 6.600 Y Krtap19-2 n/a
5 TRCN0000251979 GGCTATGGAGGCTATGGATAT pLKO_005 312 CDS 100% 10.800 5.400 Y Krtap19-2 n/a
6 TRCN0000251981 GGCTATGGAGGCTTCGGATAT pLKO_005 123 CDS 100% 10.800 5.400 Y Krtap19-2 n/a
7 TRCN0000195883 CTTTGGATATGGCTCTGGCTA pLKO.1 170 CDS 100% 2.640 1.320 Y Krtap19-2 n/a
8 TRCN0000244015 GGCTATGGAGGCTACGGATAT pLKO_005 186 CDS 100% 10.800 6.480 N KRTAP19-1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_130870.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.