Transcript: Mouse NM_133187.3

Mus musculus family with sequence similarity 198, member B (Fam198b), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Fam198b (68659)
Length:
6627
CDS:
298..1851

Additional Resources:

NCBI RefSeq record:
NM_133187.3
NBCI Gene record:
Fam198b (68659)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133187.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000266945 TCGTTACAAACGACCAGTATA pLKO_005 2404 3UTR 100% 13.200 18.480 N Fam198b n/a
2 TRCN0000266946 TGGTTAGACCATCCCTTATAC pLKO_005 731 CDS 100% 13.200 18.480 N Fam198b n/a
3 TRCN0000283387 ATATCCGTGGCACGGTGAAAC pLKO_005 656 CDS 100% 10.800 15.120 N Fam198b n/a
4 TRCN0000266944 TATAATCGCTTGGATACAAAT pLKO_005 1420 CDS 100% 13.200 9.240 N Fam198b n/a
5 TRCN0000283386 TAGAAGGCATCCGAGAGTTTC pLKO_005 1628 CDS 100% 10.800 7.560 N Fam198b n/a
6 TRCN0000173395 GCTGACCTTGAACTCAGAAAT pLKO.1 3028 3UTR 100% 13.200 6.600 Y Rbm34 n/a
7 TRCN0000087204 CAGGACCAGACGGAACCTCTT pLKO.1 393 CDS 100% 1.350 0.810 N LOC433830 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133187.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11972 pDONR223 100% 41.1% 42.3% None (many diffs) n/a
2 ccsbBroad304_11972 pLX_304 0% 41.1% 42.3% V5 (many diffs) n/a
3 TRCN0000466219 GCATTGATCAACGAAACTATTGGT pLX_317 62.7% 41.1% 42.3% V5 (many diffs) n/a
Download CSV