Transcript: Human NM_133329.6

Homo sapiens potassium voltage-gated channel modifier subfamily G member 3 (KCNG3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-12
Taxon:
Homo sapiens (human)
Gene:
KCNG3 (170850)
Length:
3709
CDS:
482..1792

Additional Resources:

NCBI RefSeq record:
NM_133329.6
NBCI Gene record:
KCNG3 (170850)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_133329.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044023 GCCGTATTACATCTCTGTGTT pLKO.1 1270 CDS 100% 4.950 6.930 N KCNG3 n/a
2 TRCN0000044024 CCTCCGGGATAATTGAAGCTA pLKO.1 1140 CDS 100% 3.000 4.200 N KCNG3 n/a
3 TRCN0000044027 GTACTTAGAATGATGAGGATT pLKO.1 1349 CDS 100% 4.950 3.960 N KCNG3 n/a
4 TRCN0000416202 CTTTGATGCTGCTTCATATTT pLKO_005 1833 3UTR 100% 15.000 10.500 N KCNG3 n/a
5 TRCN0000418013 AGTGCATCGTGAGGTTCATTG pLKO_005 1185 CDS 100% 10.800 7.560 N KCNG3 n/a
6 TRCN0000419799 GGAATTGTTCTATTGGCATTA pLKO_005 1670 CDS 100% 10.800 7.560 N KCNG3 n/a
7 TRCN0000414428 TCATCATCTTGGTAGGGTAAA pLKO_005 1891 3UTR 100% 10.800 7.560 N KCNG3 n/a
8 TRCN0000044026 GCAGTGTTATCATGAGCTCAA pLKO.1 1720 CDS 100% 4.050 2.835 N KCNG3 n/a
9 TRCN0000069386 GCTCTCCTTCTACAACGAGAT pLKO.1 754 CDS 100% 4.050 2.835 N Kcng3 n/a
10 TRCN0000044025 GCTATGGAGATATGTATCCTA pLKO.1 1605 CDS 100% 3.000 2.100 N KCNG3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133329.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05160 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05160 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468853 GAAACTCGACAAAAGGAAATTCAT pLX_317 29.8% 100% 100% V5 n/a
Download CSV