Transcript: Human NM_133373.5

Homo sapiens phospholipase C delta 3 (PLCD3), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
PLCD3 (113026)
Length:
6132
CDS:
106..2475

Additional Resources:

NCBI RefSeq record:
NM_133373.5
NBCI Gene record:
PLCD3 (113026)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_133373.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437927 GCAGTGTGGCTACGTCCTAAA pLKO_005 2001 CDS 100% 10.800 15.120 N PLCD3 n/a
2 TRCN0000437494 AGCGAGCGCAAAGCCAAGAAA pLKO_005 1780 CDS 100% 5.625 3.938 N PLCD3 n/a
3 TRCN0000053687 CCTCACCTCCAAGATTCTCTT pLKO.1 1305 CDS 100% 4.950 3.465 N PLCD3 n/a
4 TRCN0000053683 CGTGCTCAACAATGGCTTCAA pLKO.1 2223 CDS 100% 4.950 3.465 N PLCD3 n/a
5 TRCN0000053684 GCCAGTTTACACTGCCTCTTA pLKO.1 2351 CDS 100% 4.950 3.465 N PLCD3 n/a
6 TRCN0000053686 GCGGATGAACTCAGCCAACTA pLKO.1 1875 CDS 100% 4.950 3.465 N PLCD3 n/a
7 TRCN0000053685 CGTGGACATGAACGACATGTA pLKO.1 750 CDS 100% 0.495 0.347 N PLCD3 n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4887 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3689 3UTR 100% 4.950 2.475 Y KAAG1 n/a
10 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 5120 3UTR 100% 2.640 1.320 Y LINC01098 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4887 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133373.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09384 pDONR223 100% 99.9% 100% None 1450T>C n/a
2 TRCN0000476382 GCCGCCGGCAGGTACTAGGAGAGC pLX_317 13.3% 99.9% 100% V5 1450T>C n/a
Download CSV