Transcript: Human NM_133465.4

Homo sapiens KIAA1958 (KIAA1958), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
KIAA1958 (158405)
Length:
11795
CDS:
317..2467

Additional Resources:

NCBI RefSeq record:
NM_133465.4
NBCI Gene record:
KIAA1958 (158405)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_133465.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420620 CCTTGAATGTGTGGCGTTATT pLKO_005 1596 CDS 100% 13.200 18.480 N KIAA1958 n/a
2 TRCN0000131061 CGGATCTGATGTATGGTGACA pLKO.1 2043 CDS 100% 2.640 3.696 N KIAA1958 n/a
3 TRCN0000128495 GATGAGTCTAAATCATTCGGA pLKO.1 2643 3UTR 100% 0.750 1.050 N KIAA1958 n/a
4 TRCN0000177096 CAAACCTGAAACACTTGCTTT pLKO.1 405 CDS 100% 4.950 3.960 N E130308A19Rik n/a
5 TRCN0000439550 TGCTTATCACTGGCCACTAAC pLKO_005 478 CDS 100% 10.800 7.560 N KIAA1958 n/a
6 TRCN0000127558 CCTCCTCTACAAGTACATGTA pLKO.1 2209 CDS 100% 4.950 3.465 N KIAA1958 n/a
7 TRCN0000131163 GATCTGTGTACCAGTGCAGTA pLKO.1 1544 CDS 100% 4.050 2.835 N KIAA1958 n/a
8 TRCN0000130579 CCTGAAACACTTGCTTTCTGA pLKO.1 409 CDS 100% 3.000 2.100 N KIAA1958 n/a
9 TRCN0000129319 CCTCAAAGCATTGCTCGCAAA pLKO.1 815 CDS 100% 4.050 2.430 N KIAA1958 n/a
10 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 4930 3UTR 100% 4.950 2.475 Y NPHS1 n/a
11 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 4969 3UTR 100% 4.050 2.025 Y P3H4 n/a
12 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 4969 3UTR 100% 4.050 2.025 Y ORAI2 n/a
13 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 4969 3UTR 100% 4.050 2.025 Y P3H4 n/a
14 TRCN0000161892 GCCTGTAATTCCAGCTACTTA pLKO.1 9847 3UTR 100% 5.625 2.813 Y GPN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133465.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.