Transcript: Mouse NM_133718.4

Mus musculus transmembrane protein 30A (Tmem30a), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Tmem30a (69981)
Length:
3680
CDS:
221..1315

Additional Resources:

NCBI RefSeq record:
NM_133718.4
NBCI Gene record:
Tmem30a (69981)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133718.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000319435 ATCATCGTCGCTACGTGAAAT pLKO_005 609 CDS 100% 13.200 18.480 N Tmem30a n/a
2 TRCN0000319437 CCGTGAGATCGAGATTGATTA pLKO_005 445 CDS 100% 13.200 18.480 N Tmem30a n/a
3 TRCN0000087888 CCTGTTGTAAATAGGAAGAAT pLKO.1 3323 3UTR 100% 5.625 7.875 N Tmem30a n/a
4 TRCN0000087891 CGTAAGTTGTATCGTCTCATA pLKO.1 1037 CDS 100% 4.950 6.930 N Tmem30a n/a
5 TRCN0000319509 GAGTTGTACTGCTAGTAATTA pLKO_005 1248 CDS 100% 15.000 12.000 N Tmem30a n/a
6 TRCN0000087889 CGGATGATCTTGAGCACTATT pLKO.1 1154 CDS 100% 13.200 9.240 N Tmem30a n/a
7 TRCN0000317704 CGGATGATCTTGAGCACTATT pLKO_005 1154 CDS 100% 13.200 9.240 N Tmem30a n/a
8 TRCN0000087892 GACCCTGAAGATGAAAGTAAT pLKO.1 956 CDS 100% 13.200 9.240 N Tmem30a n/a
9 TRCN0000319510 GATGCTGTGTTGATAACATAT pLKO_005 1643 3UTR 100% 13.200 9.240 N Tmem30a n/a
10 TRCN0000087890 GCCAGTTAAATGGAGACCCTA pLKO.1 642 CDS 100% 2.640 1.848 N Tmem30a n/a
11 TRCN0000164120 CTGGGAGTTGTACTGCTAGTA pLKO.1 1244 CDS 100% 4.950 2.970 N TMEM30A n/a
12 TRCN0000344216 CTGGGAGTTGTACTGCTAGTA pLKO_005 1244 CDS 100% 4.950 2.970 N TMEM30A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133718.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03649 pDONR223 100% 79.1% 79.9% None (many diffs) n/a
2 ccsbBroad304_03649 pLX_304 0% 79.1% 79.9% V5 (many diffs) n/a
3 TRCN0000467656 GTTGGCCCCAGAGGCCTTATAGCA pLX_317 31.7% 79.1% 79.9% V5 (many diffs) n/a
Download CSV