Transcript: Mouse NM_133738.1

Mus musculus anthrax toxin receptor 2 (Antxr2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Antxr2 (71914)
Length:
3776
CDS:
414..1877

Additional Resources:

NCBI RefSeq record:
NM_133738.1
NBCI Gene record:
Antxr2 (71914)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133738.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000174636 GTAGCAAATAACTGGATTGAA pLKO.1 576 CDS 100% 5.625 7.875 N Antxr2 n/a
2 TRCN0000216396 GAAGTTTCAATCAGCTATAAT pLKO.1 1287 CDS 100% 15.000 12.000 N Antxr2 n/a
3 TRCN0000346979 AGGCATCATCAACTCTATATT pLKO_005 1034 CDS 100% 15.000 10.500 N Antxr2 n/a
4 TRCN0000346909 TCTTCCCAAGCAACCATTATT pLKO_005 669 CDS 100% 15.000 10.500 N Antxr2 n/a
5 TRCN0000346980 TGAAGTTTCAATCAGCTATAA pLKO_005 1286 CDS 100% 13.200 9.240 N Antxr2 n/a
6 TRCN0000193940 CATGTACTGAAATCCTGGAAT pLKO.1 1063 CDS 100% 4.950 3.465 N Antxr2 n/a
7 TRCN0000194330 CCGAAGGAAATAGCTCAGATA pLKO.1 3227 3UTR 100% 4.950 3.465 N Antxr2 n/a
8 TRCN0000346908 CCGAAGGAAATAGCTCAGATA pLKO_005 3227 3UTR 100% 4.950 3.465 N Antxr2 n/a
9 TRCN0000173757 CCTCTGTACATTCACTGCAAA pLKO.1 1172 CDS 100% 4.950 3.465 N Antxr2 n/a
10 TRCN0000173758 CGGGAGAACAAAGAATGAGAA pLKO.1 1880 3UTR 100% 4.950 3.465 N Antxr2 n/a
11 TRCN0000346907 CGGGAGAACAAAGAATGAGAA pLKO_005 1880 3UTR 100% 4.950 3.465 N Antxr2 n/a
12 TRCN0000193404 CTCCAGTATCATAATTGCTTT pLKO.1 830 CDS 100% 4.950 3.465 N Antxr2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133738.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13067 pDONR223 100% 26.5% 27.2% None (many diffs) n/a
2 ccsbBroad304_13067 pLX_304 0% 26.5% 27.2% V5 (many diffs) n/a
3 TRCN0000468982 TTGTCGCGATATGTGCAGCCCCCG pLX_317 86.7% 26.5% 27.2% V5 (many diffs) n/a
Download CSV