Transcript: Mouse NM_133761.3

Mus musculus decapping mRNA 1A (Dcp1a), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Dcp1a (75901)
Length:
5616
CDS:
58..1866

Additional Resources:

NCBI RefSeq record:
NM_133761.3
NBCI Gene record:
Dcp1a (75901)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133761.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096665 CCTCGGAATAGCACCATGATA pLKO.1 1120 CDS 100% 5.625 7.875 N Dcp1a n/a
2 TRCN0000096667 CCAAGCACTCAGCTCTCTAAT pLKO.1 670 CDS 100% 13.200 9.240 N Dcp1a n/a
3 TRCN0000096664 GCCCTGTTCAAGAATCCAGAA pLKO.1 5005 3UTR 100% 4.050 2.835 N Dcp1a n/a
4 TRCN0000096668 GCAGGTTCTGACCAAGAACAA pLKO.1 1827 CDS 100% 0.495 0.347 N Dcp1a n/a
5 TRCN0000021012 CCATTTCCCTTTGAGCAGTTA pLKO.1 892 CDS 100% 4.950 3.465 N DCP1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133761.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03658 pDONR223 100% 85.2% 86.2% None (many diffs) n/a
2 ccsbBroad304_03658 pLX_304 0% 85.2% 86.2% V5 (many diffs) n/a
3 TRCN0000479675 ATTATTACCGATCCATTACTGACG pLX_317 18.8% 85.2% 86.2% V5 (many diffs) n/a
Download CSV