Transcript: Mouse NM_133803.2

Mus musculus dipeptidylpeptidase 3 (Dpp3), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Dpp3 (75221)
Length:
2683
CDS:
74..2290

Additional Resources:

NCBI RefSeq record:
NM_133803.2
NBCI Gene record:
Dpp3 (75221)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133803.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000349875 GAGGGAGTCACCACCTATTTC pLKO_005 569 CDS 100% 13.200 18.480 N Dpp3 n/a
2 TRCN0000313072 TTACCGTATGTCCTCAGTTTC pLKO_005 2457 3UTR 100% 10.800 8.640 N Dpp3 n/a
3 TRCN0000313116 AGAGACGTGGGATAGCAAATT pLKO_005 1549 CDS 100% 13.200 9.240 N Dpp3 n/a
4 TRCN0000348638 AGGAGTCCCGGAAGCTTATTG pLKO_005 2070 CDS 100% 13.200 9.240 N Dpp3 n/a
5 TRCN0000348637 GGATCTGCACTGCCATCTATG pLKO_005 2479 3UTR 100% 10.800 7.560 N Dpp3 n/a
6 TRCN0000220553 CCCATTGTAGAGAGTTACATT pLKO.1 989 CDS 100% 5.625 3.938 N Dpp3 n/a
7 TRCN0000349416 CCCATTGTAGAGAGTTACATT pLKO_005 989 CDS 100% 5.625 3.938 N Dpp3 n/a
8 TRCN0000220555 CTACGTGAACTGGCTCAACAT pLKO.1 1690 CDS 100% 4.950 3.465 N Dpp3 n/a
9 TRCN0000220556 TGACACCAAGTTTGTTCCTAA pLKO.1 403 CDS 100% 4.950 3.465 N Dpp3 n/a
10 TRCN0000312136 TGACACCAAGTTTGTTCCTAA pLKO_005 403 CDS 100% 4.950 3.465 N Dpp3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133803.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07545 pDONR223 100% 87.6% 92.8% None (many diffs) n/a
2 ccsbBroad304_07545 pLX_304 0% 87.6% 92.8% V5 (many diffs) n/a
3 ccsbBroadEn_07546 pDONR223 100% 87.5% 92.6% None (many diffs) n/a
4 ccsbBroad304_07546 pLX_304 0% 87.5% 92.6% V5 (many diffs) n/a
5 TRCN0000475438 CTTTAGCTGAGGCGGCCAGTGGTT pLX_317 22.2% 87.5% 92.6% V5 (many diffs) n/a
Download CSV