Transcript: Mouse NM_133911.1

Mus musculus adhesion G protein-coupled receptor A3 (Adgra3), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Adgra3 (70693)
Length:
4475
CDS:
222..4154

Additional Resources:

NCBI RefSeq record:
NM_133911.1
NBCI Gene record:
Adgra3 (70693)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133911.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238972 AGACACCCTGAGCGCAAATAT pLKO_005 3018 CDS 100% 15.000 21.000 N Adgra3 n/a
2 TRCN0000238973 ACCTCCGGAACAACCTTATTA pLKO_005 520 CDS 100% 15.000 10.500 N Adgra3 n/a
3 TRCN0000238970 ACTCGATGGACAACGATATTA pLKO_005 3622 CDS 100% 15.000 10.500 N Adgra3 n/a
4 TRCN0000238971 AGGAGTAGGAGAGCTTATTTA pLKO_005 3843 CDS 100% 15.000 10.500 N Adgra3 n/a
5 TRCN0000238969 AGCTTTGGGATTTACTTATTT pLKO_005 4279 3UTR 100% 15.000 9.000 N Adgra3 n/a
6 TRCN0000138161 CCTGAGCGCAAATATGAGCTT pLKO.1 3024 CDS 100% 2.640 1.848 N ADGRA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133911.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13344 pDONR223 100% 24.6% 26.9% None (many diffs) n/a
2 ccsbBroad304_13344 pLX_304 0% 24.6% 26.9% V5 (many diffs) n/a
Download CSV