Transcript: Mouse NM_133925.2

Mus musculus RNA binding motif protein 28 (Rbm28), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Rbm28 (68272)
Length:
4201
CDS:
117..2369

Additional Resources:

NCBI RefSeq record:
NM_133925.2
NBCI Gene record:
Rbm28 (68272)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133925.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000449757 GACAGCTCAAGGTCGACTTAG pLKO_005 1315 CDS 100% 10.800 15.120 N Rbm28 n/a
2 TRCN0000446829 TACTAAAGTAGTCTCTGAATG pLKO_005 2807 3UTR 100% 10.800 15.120 N Rbm28 n/a
3 TRCN0000102271 CGGGACCTTAAAGGAGTTCAT pLKO.1 1662 CDS 100% 4.950 6.930 N Rbm28 n/a
4 TRCN0000239462 AGATAAGAAAGCCAGATTAAT pLKO_005 446 CDS 100% 15.000 10.500 N RBM28 n/a
5 TRCN0000449071 GAGTCTGTGATTGCAACTTAA pLKO_005 2549 3UTR 100% 13.200 9.240 N Rbm28 n/a
6 TRCN0000447470 CTGAATTGTAAAGATGCATAT pLKO_005 2631 3UTR 100% 10.800 7.560 N Rbm28 n/a
7 TRCN0000102272 GCATTCTAAAGGTTGTGCATT pLKO.1 1205 CDS 100% 4.950 3.465 N Rbm28 n/a
8 TRCN0000102274 GCTAAGGAGAATAAGGCAGAA pLKO.1 2250 CDS 100% 4.050 2.835 N Rbm28 n/a
9 TRCN0000176490 CCTGGGTTCTATAAGAAAGTA pLKO.1 4008 3UTR 100% 5.625 2.813 Y Il1bos n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133925.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.