Transcript: Mouse NM_133969.2

Mus musculus cytochrome P450, family 4, subfamily v, polypeptide 3 (Cyp4v3), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Cyp4v3 (102294)
Length:
2930
CDS:
219..1796

Additional Resources:

NCBI RefSeq record:
NM_133969.2
NBCI Gene record:
Cyp4v3 (102294)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133969.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031638 GCCGATCATTAAACTTTGGAT pLKO.1 479 CDS 100% 3.000 4.200 N Cyp4v3 n/a
2 TRCN0000288045 GCCGATCATTAAACTTTGGAT pLKO_005 479 CDS 100% 3.000 4.200 N Cyp4v3 n/a
3 TRCN0000031636 CGCGCTTTATATGAAGCCCAA pLKO.1 404 CDS 100% 2.160 1.728 N Cyp4v3 n/a
4 TRCN0000295388 ATAGGATGAGTGATATGATAT pLKO_005 889 CDS 100% 13.200 9.240 N Cyp4v3 n/a
5 TRCN0000295444 GTCATCAGAGATATCAGTTAT pLKO_005 2229 3UTR 100% 13.200 9.240 N Cyp4v3 n/a
6 TRCN0000031634 CCACAGAAACTTCCTGGTTAT pLKO.1 2472 3UTR 100% 10.800 7.560 N Cyp4v3 n/a
7 TRCN0000031637 GCTCTGGATATAATCTGTGAA pLKO.1 804 CDS 100% 4.950 3.465 N Cyp4v3 n/a
8 TRCN0000288046 GCTCTGGATATAATCTGTGAA pLKO_005 804 CDS 100% 4.950 3.465 N Cyp4v3 n/a
9 TRCN0000031635 GCTGCAATCAACTGGTCCTTA pLKO.1 1224 CDS 100% 4.950 3.465 N Cyp4v3 n/a
10 TRCN0000288119 GCTGCAATCAACTGGTCCTTA pLKO_005 1224 CDS 100% 4.950 3.465 N Cyp4v3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133969.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.