Transcript: Mouse NM_134000.3

Mus musculus TRAF3 interacting protein 2 (Traf3ip2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Traf3ip2 (103213)
Length:
2867
CDS:
422..2089

Additional Resources:

NCBI RefSeq record:
NM_134000.3
NBCI Gene record:
Traf3ip2 (103213)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_134000.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105990 CCAGTCTAAATCATGCTCAAA pLKO.1 2341 3UTR 100% 4.950 3.960 N Traf3ip2 n/a
2 TRCN0000305900 CAAACTGCGATTGACATATTT pLKO_005 1673 CDS 100% 15.000 10.500 N Traf3ip2 n/a
3 TRCN0000305897 TCAGTGGAGGTGGGCATATTA pLKO_005 2399 3UTR 100% 15.000 10.500 N Traf3ip2 n/a
4 TRCN0000305964 AGAACCATTCCCGAGTCAATT pLKO_005 457 CDS 100% 13.200 9.240 N Traf3ip2 n/a
5 TRCN0000105993 CCCTGAACTTGGCAAAGATAT pLKO.1 679 CDS 100% 13.200 9.240 N Traf3ip2 n/a
6 TRCN0000105994 CCTGAACTTGGCAAAGATATT pLKO.1 680 CDS 100% 13.200 9.240 N Traf3ip2 n/a
7 TRCN0000105992 GCTTCAGAACACTCATGTTTA pLKO.1 1960 CDS 100% 13.200 9.240 N Traf3ip2 n/a
8 TRCN0000325135 GCTTCAGAACACTCATGTTTA pLKO_005 1960 CDS 100% 13.200 9.240 N Traf3ip2 n/a
9 TRCN0000305899 GGAGCGCTATCTTCGAGATAA pLKO_005 1732 CDS 100% 13.200 9.240 N Traf3ip2 n/a
10 TRCN0000105991 CCACCATCTAATGGAGTGGAA pLKO.1 1430 CDS 100% 2.640 1.848 N Traf3ip2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134000.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07674 pDONR223 100% 82.7% 78.7% None (many diffs) n/a
2 ccsbBroad304_07674 pLX_304 0% 82.7% 78.7% V5 (many diffs) n/a
3 TRCN0000477300 AGGTGTCGGCCGTTAGCTATAACC pLX_317 24.7% 82.7% 78.7% V5 (many diffs) n/a
Download CSV