Transcript: Mouse NM_134009.3

Mus musculus nicalin (Ncln), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Ncln (103425)
Length:
2893
CDS:
101..1792

Additional Resources:

NCBI RefSeq record:
NM_134009.3
NBCI Gene record:
Ncln (103425)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_134009.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113297 GTCCGGCAATTCATGGAGATT pLKO.1 470 CDS 100% 4.950 3.960 N Ncln n/a
2 TRCN0000325416 GTCCGGCAATTCATGGAGATT pLKO_005 470 CDS 100% 4.950 3.960 N Ncln n/a
3 TRCN0000113295 CCACGGTGAATCAATTCAATA pLKO.1 2483 3UTR 100% 13.200 9.240 N Ncln n/a
4 TRCN0000325489 CCACGGTGAATCAATTCAATA pLKO_005 2483 3UTR 100% 13.200 9.240 N Ncln n/a
5 TRCN0000113296 CCATTGTCATCGTGGCTCATT pLKO.1 753 CDS 100% 4.950 3.465 N Ncln n/a
6 TRCN0000325415 CCATTGTCATCGTGGCTCATT pLKO_005 753 CDS 100% 4.950 3.465 N Ncln n/a
7 TRCN0000113298 GTTTGTCTTCTATGACCAGTT pLKO.1 1609 CDS 100% 4.050 2.835 N Ncln n/a
8 TRCN0000325417 GTTTGTCTTCTATGACCAGTT pLKO_005 1609 CDS 100% 4.050 2.835 N Ncln n/a
9 TRCN0000113299 GCCAGTGTTCACGGAGCAGAT pLKO.1 1414 CDS 100% 1.350 0.945 N Ncln n/a
10 TRCN0000325479 GCCAGTGTTCACGGAGCAGAT pLKO_005 1414 CDS 100% 1.350 0.945 N Ncln n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134009.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12313 pDONR223 100% 85.4% 91.4% None (many diffs) n/a
2 ccsbBroad304_12313 pLX_304 0% 85.4% 91.4% V5 (many diffs) n/a
3 TRCN0000473970 CTCCACGGCGGACGTAGCCCGCTC pLX_317 27.9% 85.4% 91.4% V5 (many diffs) n/a
Download CSV