Transcript: Mouse NM_134067.4

Mus musculus expressed sequence AW209491 (AW209491), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
AW209491 (105351)
Length:
2010
CDS:
372..1637

Additional Resources:

NCBI RefSeq record:
NM_134067.4
NBCI Gene record:
AW209491 (105351)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_134067.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329422 CCGATGATAGTGCGCACTAAT pLKO_005 1618 CDS 100% 13.200 18.480 N AW209491 n/a
2 TRCN0000175105 GCCGTCAACTCTCTATTAAAT pLKO.1 951 CDS 100% 15.000 10.500 N AW209491 n/a
3 TRCN0000329484 GCCGTCAACTCTCTATTAAAT pLKO_005 951 CDS 100% 15.000 10.500 N AW209491 n/a
4 TRCN0000175759 GCCAACAATCAGGGTGTTAAA pLKO.1 1518 CDS 100% 13.200 9.240 N AW209491 n/a
5 TRCN0000329486 GCCAACAATCAGGGTGTTAAA pLKO_005 1518 CDS 100% 13.200 9.240 N AW209491 n/a
6 TRCN0000175206 CGATGTGCTAATTAAACGAAT pLKO.1 1352 CDS 100% 4.950 3.465 N AW209491 n/a
7 TRCN0000329485 CGATGTGCTAATTAAACGAAT pLKO_005 1352 CDS 100% 4.950 3.465 N AW209491 n/a
8 TRCN0000175760 GTTGTAGCAAATGGAGGTCAT pLKO.1 693 CDS 100% 4.050 2.835 N AW209491 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134067.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04028 pDONR223 100% 88.1% 92.6% None (many diffs) n/a
2 ccsbBroad304_04028 pLX_304 0% 88.1% 92.6% V5 (many diffs) n/a
3 TRCN0000465765 CTTATAACTCTGCTTACGCATACA pLX_317 11.5% 88.1% 92.6% V5 (many diffs) n/a
Download CSV