Transcript: Mouse NM_134076.2

Mus musculus abhydrolase domain containing 4 (Abhd4), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Abhd4 (105501)
Length:
2406
CDS:
27..1094

Additional Resources:

NCBI RefSeq record:
NM_134076.2
NBCI Gene record:
Abhd4 (105501)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_134076.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032558 GCGAATCCACTTAATTCGAAA pLKO.1 881 CDS 100% 0.495 0.693 N Abhd4 n/a
2 TRCN0000326288 GCGAATCCACTTAATTCGAAA pLKO_005 881 CDS 100% 0.495 0.693 N Abhd4 n/a
3 TRCN0000032555 CCGTTATGTATCCCTCCCAAA pLKO.1 200 CDS 100% 4.050 3.240 N Abhd4 n/a
4 TRCN0000306193 GGATGACACCATCTCGGAATA pLKO_005 767 CDS 100% 10.800 7.560 N Abhd4 n/a
5 TRCN0000306192 GTATATCCCAAGCTCTCATTG pLKO_005 1594 3UTR 100% 10.800 7.560 N Abhd4 n/a
6 TRCN0000032556 CCAGACTTCAAGCGCAAGTTT pLKO.1 732 CDS 100% 5.625 3.938 N Abhd4 n/a
7 TRCN0000326286 CCAGACTTCAAGCGCAAGTTT pLKO_005 732 CDS 100% 5.625 3.938 N Abhd4 n/a
8 TRCN0000032557 CGCACACTTCATACCTTTGAT pLKO.1 348 CDS 100% 5.625 3.938 N Abhd4 n/a
9 TRCN0000326287 CGCACACTTCATACCTTTGAT pLKO_005 348 CDS 100% 5.625 3.938 N Abhd4 n/a
10 TRCN0000032554 GCAAGAGATAAGGGCAGGATA pLKO.1 1624 3UTR 100% 4.950 3.465 N Abhd4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134076.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03902 pDONR223 100% 87.6% 92.9% None (many diffs) n/a
2 ccsbBroad304_03902 pLX_304 0% 87.6% 92.9% V5 (many diffs) n/a
3 TRCN0000475126 CTATCAAGTACTGAGGACATGGTA pLX_317 2.4% 87.6% 92.9% V5 (many diffs) n/a
4 ccsbBroadEn_03903 pDONR223 100% 87.6% 92.9% None (many diffs) n/a
5 ccsbBroad304_03903 pLX_304 0% 87.6% 92.9% V5 (many diffs) n/a
6 TRCN0000476601 GGCTCACAACAACTTTAGGAACAT pLX_317 37.5% 87.6% 92.9% V5 (many diffs) n/a
Download CSV