Construct: ORF TRCN0000476601
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014221.1_s317c1
- Derived from:
- ccsbBroadEn_03903
- DNA Barcode:
- GGCTCACAACAACTTTAGGAACAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ABHD4 (63874)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476601
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 63874 | ABHD4 | abhydrolase domain containi... | NM_022060.2 | 100% | 100% | |
2 | human | 63874 | ABHD4 | abhydrolase domain containi... | XM_005267986.4 | 92.9% | 92.9% | 0_1ins72 |
3 | human | 63874 | ABHD4 | abhydrolase domain containi... | XR_245712.4 | 33.8% | 1_9delTTGTTTACT;650_729del;1116_3034del | |
4 | human | 63874 | ABHD4 | abhydrolase domain containi... | XR_001750499.1 | 32.6% | (many diffs) | |
5 | mouse | 105501 | Abhd4 | abhydrolase domain containi... | NM_134076.2 | 87.6% | 92.9% | (many diffs) |
6 | mouse | 105501 | Abhd4 | abhydrolase domain containi... | NM_001205181.1 | 84.4% | 89.7% | (many diffs) |
7 | mouse | 105501 | Abhd4 | abhydrolase domain containi... | XM_006518367.2 | 84.4% | 89.7% | (many diffs) |
8 | mouse | 105501 | Abhd4 | abhydrolase domain containi... | XR_383129.2 | 46.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1092
- ORF length:
- 1026
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc cgatgatctg gagcagcagt ctcaaggctg gctgagtagc tggctgccca 121 cgtggcgccc cacttccatg tctcagctga agaatgtgga agccaggatc ctccagtgtc 181 tccagaataa gttcctggcc agatatgtat ccctcccaaa ccagaataag atctggacgg 241 tgactgtgag ccccgagcaa aacgaccgca cccccttggt gatggtgcat ggttttgggg 301 gcggcgtggg tctctggatc ctcaacatgg actcactgag tgcccgccgc acactgcaca 361 ccttcgatct gcttggcttc gggcgaagct caaggccagc attcccaagg gacccggagg 421 gggctgagga tgagtttgtg acatcgatag agacatggcg ggagaccatg gggatcccca 481 gcatgatcct cctggggcac agtttgggag gattcctggc cacttcttac tcaatcaagt 541 accctgatag agttaaacac ctcatcctgg tggacccatg gggctttccc ctccgaccaa 601 ctaaccccag tgagatccgt gcacccccag cctgggtcaa agccgtggca tctgtcctag 661 gacgttccaa tccattggct gttcttcgag tagctgggcc ctgggggccT GGTCTGGTGC 721 AGCGATTCCG GCCGGACTTC AAACGCAAGT TTGCAGACTT CTTTGAAGAT GATACCATAT 781 CAGAGTATAT TTACCACTGC AACGCACAGA ATCCCAGTGG TGAGACAGCA TTCAAAGCCA 841 TGATGGAGTC CTTTGGCTGG GCCCGGCGCC CTATGCTGGA GCGAATTCAC TTGATTCGAA 901 AAGATGTGCC TATCACTATG ATCTACGGGT CCGACACCTG GATAGATACC AGTACGGGAA 961 AAAAGGTGAA GATGCAGCGG CCGGATTCCT ATGTCCGAGA CATGGAGATT AAGGGTGCCT 1021 CCCACCATGT CTATGCTGAC CAGCCACACA TCTTCAATGC TGTGGTGGAG GAGATCTGCG 1081 ACTCAGTTGA TTGCCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1141 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1201 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGAGGC TCACAACAAC TTTAGGAACA 1261 TACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t