Transcript: Mouse NM_134151.4

Mus musculus tyrosyl-tRNA synthetase (Yars), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Yars (107271)
Length:
2874
CDS:
114..1808

Additional Resources:

NCBI RefSeq record:
NM_134151.4
NBCI Gene record:
Yars (107271)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_134151.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075724 GCTGCATCTTATCACCCGGAA pLKO.1 251 CDS 100% 2.160 3.024 N Yars n/a
2 TRCN0000075726 CGTCTCCTGTAAATCACTAAA pLKO.1 1769 CDS 100% 13.200 9.240 N Yars n/a
3 TRCN0000075727 CCCTTGGAGAAGCTCAAGTTT pLKO.1 552 CDS 100% 5.625 3.938 N Yars n/a
4 TRCN0000075725 CGAACCAGTTACTATGAGAAT pLKO.1 498 CDS 100% 4.950 3.465 N Yars n/a
5 TRCN0000075723 GCCACTGTCAAGTTCAAATAA pLKO.1 2468 3UTR 100% 15.000 9.000 N Yars n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134151.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01958 pDONR223 100% 83.8% 90.4% None (many diffs) n/a
2 ccsbBroad304_01958 pLX_304 0% 83.8% 90.4% V5 (many diffs) n/a
3 TRCN0000467421 CTATCCCGCCAGCTTGCGTGCTTA pLX_317 26.1% 83.8% 90.4% V5 (many diffs) n/a
Download CSV