Transcript: Mouse NM_134152.3

Mus musculus leupaxin (Lpxn), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Lpxn (107321)
Length:
1673
CDS:
59..1219

Additional Resources:

NCBI RefSeq record:
NM_134152.3
NBCI Gene record:
Lpxn (107321)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_134152.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097228 CGTCCTTTCTGTGAACTCCAT pLKO.1 998 CDS 100% 2.640 2.112 N Lpxn n/a
2 TRCN0000097226 GCTGCTCCCATCACAGATAAA pLKO.1 701 CDS 100% 13.200 9.240 N Lpxn n/a
3 TRCN0000097227 CAGCTCGTGTATGCAACCAAT pLKO.1 233 CDS 100% 4.950 3.465 N Lpxn n/a
4 TRCN0000097225 CCGAAAGGATTTCTTAGCCAT pLKO.1 832 CDS 100% 2.640 1.848 N Lpxn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134152.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07411 pDONR223 100% 86.8% 85.2% None (many diffs) n/a
2 ccsbBroad304_07411 pLX_304 0% 86.8% 85.2% V5 (many diffs) n/a
3 TRCN0000473851 TCTAAACCCTGGGAGAGAGATTCA pLX_317 43.5% 86.8% 85.2% V5 (many diffs) n/a
Download CSV