Transcript: Human NM_138356.3

Homo sapiens Src homology 2 domain containing F (SHF), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
SHF (90525)
Length:
2441
CDS:
437..1708

Additional Resources:

NCBI RefSeq record:
NM_138356.3
NBCI Gene record:
SHF (90525)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138356.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265424 AGCCGCAAGCTACCCATTAAG pLKO_005 1637 CDS 100% 13.200 18.480 N SHF n/a
2 TRCN0000253650 TACAACGCGCCTGCGCATTAT pLKO_005 688 CDS 100% 13.200 18.480 N SHF n/a
3 TRCN0000253647 AGCTGGAGATTCCTTAATTTA pLKO_005 1831 3UTR 100% 15.000 10.500 N SHF n/a
4 TRCN0000253649 CTGAAATTGTGCACCACTATG pLKO_005 1614 CDS 100% 10.800 7.560 N SHF n/a
5 TRCN0000146879 CATTAAGGTCATCAAAGACCT pLKO.1 1093 CDS 100% 0.264 0.185 N SHF n/a
6 TRCN0000253648 AGTGGAAGAAGGAGCGGATTT pLKO_005 1053 CDS 100% 10.800 6.480 N SHF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138356.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14335 pDONR223 100% 50% 15.9% None (many diffs) n/a
2 ccsbBroad304_14335 pLX_304 0% 50% 15.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000479544 TGCATACGTCCCTATATTCGCGTC pLX_317 44.8% 50% 15.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV