Transcript: Human NM_138390.4

Homo sapiens transmembrane protein 169 (TMEM169), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
TMEM169 (92691)
Length:
3318
CDS:
184..1077

Additional Resources:

NCBI RefSeq record:
NM_138390.4
NBCI Gene record:
TMEM169 (92691)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138390.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122212 GTTGCTTGAATCCGACAATAT pLKO.1 999 CDS 100% 13.200 18.480 N TMEM169 n/a
2 TRCN0000122724 CGGCACTATCACCTGGTACAA pLKO.1 729 CDS 100% 4.950 6.930 N TMEM169 n/a
3 TRCN0000144480 CCTGAATCTTACACAGAGAAT pLKO.1 2437 3UTR 100% 4.950 3.960 N TMEM169 n/a
4 TRCN0000121595 CTAGACTATCCTGTGGATGAT pLKO.1 433 CDS 100% 4.950 3.960 N TMEM169 n/a
5 TRCN0000140118 GAAGGTGGAGATCAGCCTAAA pLKO.1 391 CDS 100% 10.800 7.560 N TMEM169 n/a
6 TRCN0000141545 CACTATCACCTGGTACAACAT pLKO.1 732 CDS 100% 4.950 3.465 N TMEM169 n/a
7 TRCN0000139789 CCAGGACATTTGCCTGATGTA pLKO.1 3104 3UTR 100% 4.950 3.465 N TMEM169 n/a
8 TRCN0000142048 GACTATCCTGTGGATGATGAT pLKO.1 436 CDS 100% 4.950 3.465 N TMEM169 n/a
9 TRCN0000142522 GAGTTGCTTGAATCCGACAAT pLKO.1 997 CDS 100% 4.950 3.465 N TMEM169 n/a
10 TRCN0000141206 CGACAATATCTCAAGCACTCT pLKO.1 1011 CDS 100% 2.640 1.848 N TMEM169 n/a
11 TRCN0000122890 GCAGGAACTGACCAAACCTAA pLKO.1 570 CDS 100% 4.950 2.970 N TMEM169 n/a
12 TRCN0000142612 GCCTGAATCTTACACAGAGAA pLKO.1 2436 3UTR 100% 4.950 2.970 N TMEM169 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138390.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04586 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04586 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477957 TACTGTATTATCAGGTGATGGGAG pLX_317 14.7% 100% 100% V5 n/a
Download CSV