Transcript: Human NM_138408.4

Homo sapiens general transcription factor IIIC subunit 6 (GTF3C6), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
GTF3C6 (112495)
Length:
788
CDS:
65..706

Additional Resources:

NCBI RefSeq record:
NM_138408.4
NBCI Gene record:
GTF3C6 (112495)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138408.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416857 AGTTGGTTCTGGTGGAATTAT pLKO_005 126 CDS 100% 15.000 10.500 N GTF3C6 n/a
2 TRCN0000130143 CAATGAAGAAGCTCAGCATGA pLKO.1 360 CDS 100% 4.050 2.835 N GTF3C6 n/a
3 TRCN0000425097 CGACAGTTCAAACCTGAGTTG pLKO_005 577 CDS 100% 4.050 2.835 N GTF3C6 n/a
4 TRCN0000128828 GAGAAACCAATGCACTTGGAA pLKO.1 605 CDS 100% 3.000 2.100 N GTF3C6 n/a
5 TRCN0000129372 GCTCAGCATGACAAGAACTCT pLKO.1 370 CDS 100% 3.000 2.100 N GTF3C6 n/a
6 TRCN0000129163 GCCATACAATGAAGAAGCTCA pLKO.1 354 CDS 100% 2.640 1.848 N GTF3C6 n/a
7 TRCN0000128280 GAAATAGAAGATTCTGGTCCT pLKO.1 623 CDS 100% 2.160 1.512 N GTF3C6 n/a
8 TRCN0000129991 GAATTGGAAGAGGAAGAGATT pLKO.1 548 CDS 100% 4.950 2.970 N GTF3C6 n/a
9 TRCN0000130425 GAGAAGAAGGAAGGAGAAGAA pLKO.1 398 CDS 100% 4.950 2.970 N GTF3C6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138408.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09373 pDONR223 100% 99.5% 99% None 8C>T;639_639delTinsCT n/a
Download CSV