Transcript: Human NM_138415.5

Homo sapiens PHD finger protein 21B (PHF21B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
PHF21B (112885)
Length:
3976
CDS:
457..2052

Additional Resources:

NCBI RefSeq record:
NM_138415.5
NBCI Gene record:
PHF21B (112885)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138415.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022040 CCTGGTTACCACGGAACATTT pLKO.1 1314 CDS 100% 13.200 18.480 N PHF21B n/a
2 TRCN0000359362 TTCATACCCACGGAAAGTTAT pLKO_005 2069 3UTR 100% 13.200 18.480 N PHF21B n/a
3 TRCN0000359290 CTGGCCATCGTGCACTCTTAT pLKO_005 1693 CDS 100% 13.200 9.240 N PHF21B n/a
4 TRCN0000368606 CTGTCGGCCTTAATTCATAAA pLKO_005 2119 3UTR 100% 13.200 9.240 N PHF21B n/a
5 TRCN0000359291 GTGCCAGCAGAAGGCCTTAAA pLKO_005 1641 CDS 100% 13.200 9.240 N PHF21B n/a
6 TRCN0000022041 GTTAGGCCAAAGACTCTGATT pLKO.1 670 CDS 100% 4.950 3.465 N PHF21B n/a
7 TRCN0000022039 GCACTCTTATGTCACCCACAA pLKO.1 1704 CDS 100% 4.050 2.835 N PHF21B n/a
8 TRCN0000022042 GTCATCATCATTCAGCCTCAA pLKO.1 1147 CDS 100% 4.050 2.835 N PHF21B n/a
9 TRCN0000022043 AGTGCAGAAATGCCTGGAGTT pLKO.1 1827 CDS 100% 4.050 2.430 N PHF21B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138415.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09382 pDONR223 100% 99.9% 99.8% None 15C>G n/a
2 ccsbBroad304_09382 pLX_304 0% 99.9% 99.8% V5 15C>G n/a
3 TRCN0000472632 TTTAAACCGTCACATTTAAGTGAC pLX_317 29.6% 99.9% 99.8% V5 15C>G n/a
Download CSV