Transcript: Human NM_138439.3

Homo sapiens FLYWCH family member 2 (FLYWCH2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
FLYWCH2 (114984)
Length:
990
CDS:
352..774

Additional Resources:

NCBI RefSeq record:
NM_138439.3
NBCI Gene record:
FLYWCH2 (114984)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138439.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243356 GGCCAAATGGGTGAATCTTTG pLKO_005 847 3UTR 100% 10.800 8.640 N FLYWCH2 n/a
2 TRCN0000243358 AGAACAGAAGACAGTGGATTA pLKO_005 682 CDS 100% 10.800 7.560 N FLYWCH2 n/a
3 TRCN0000179726 GAACAGAAGACAGTGGATTAG pLKO.1 683 CDS 100% 10.800 7.560 N FLYWCH2 n/a
4 TRCN0000243355 GTCCCTGTAACCTTGACAACA pLKO_005 765 CDS 100% 4.950 3.465 N FLYWCH2 n/a
5 TRCN0000257680 CAGGAAGCCCAGAAAGTTCTC pLKO_005 450 CDS 100% 4.050 2.835 N Flywch2 n/a
6 TRCN0000178743 CAGAAAGTTCTCCAAACTGGT pLKO.1 459 CDS 100% 2.640 1.848 N FLYWCH2 n/a
7 TRCN0000243354 CTCCAAAGACAGCACCAAGGT pLKO_005 492 CDS 100% 2.640 1.848 N FLYWCH2 n/a
8 TRCN0000180456 GACAGAACAGAAGACAGTGGA pLKO.1 679 CDS 100% 2.640 1.848 N FLYWCH2 n/a
9 TRCN0000243357 GAAAGTTCTCCAAACTGGTCC pLKO_005 461 CDS 100% 2.160 1.512 N FLYWCH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138439.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04672 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04672 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473666 AGCCGAACGTCTCAAACCCCCACC pLX_317 55% 100% 100% V5 n/a
Download CSV