Transcript: Human NM_138459.5

Homo sapiens NUS1 dehydrodolichyl diphosphate synthase subunit (NUS1), mRNA.

Source:
NCBI, updated 2019-08-23
Taxon:
Homo sapiens (human)
Gene:
NUS1 (116150)
Length:
4796
CDS:
203..1084

Additional Resources:

NCBI RefSeq record:
NM_138459.5
NBCI Gene record:
NUS1 (116150)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138459.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246710 TCTACGACCACCAAGGTATTT pLKO_005 603 CDS 100% 13.200 18.480 N Nus1 n/a
2 TRCN0000151043 GATACGTTAGCCAGTTTACTT pLKO.1 872 CDS 100% 5.625 7.875 N NUS1 n/a
3 TRCN0000155384 CGTCAATATGCAGCCTGTGAA pLKO.1 1046 CDS 100% 4.950 6.930 N NUS1 n/a
4 TRCN0000150965 GCATGGTTAATACCTGAGATT pLKO.1 2146 3UTR 100% 4.950 6.930 N NUS1 n/a
5 TRCN0000151210 GCACGTTTGTATGTATGGAAA pLKO.1 1274 3UTR 100% 4.950 3.960 N NUS1 n/a
6 TRCN0000246709 CCAGATTGATGGATGAAATTT pLKO_005 639 CDS 100% 15.000 10.500 N Nus1 n/a
7 TRCN0000419860 CCTACAACTTTGAGCAAATAG pLKO_005 1338 3UTR 100% 13.200 9.240 N NUS1 n/a
8 TRCN0000246711 GGTCCTGTGGACAGCACATTA pLKO_005 935 CDS 100% 13.200 9.240 N Nus1 n/a
9 TRCN0000426553 GGTTGTCCTGATCCTGATTTA pLKO_005 902 CDS 100% 13.200 9.240 N NUS1 n/a
10 TRCN0000427328 TAGTGGTCATTGGTTGCATAA pLKO_005 1082 CDS 100% 10.800 7.560 N NUS1 n/a
11 TRCN0000153268 GCAGATATTGTAAGAGCTGCT pLKO.1 794 CDS 100% 2.160 1.296 N NUS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138459.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04696 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04696 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470902 TCTAATCACGCCCGAGCCTTTATC pLX_317 45.1% 100% 100% V5 n/a
Download CSV