Transcript: Human NM_138620.1

Homo sapiens DEAD-box helicase 31 (DDX31), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
DDX31 (64794)
Length:
2408
CDS:
153..1910

Additional Resources:

NCBI RefSeq record:
NM_138620.1
NBCI Gene record:
DDX31 (64794)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138620.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232438 ATCTGCCTCCATGCGATTAAA pLKO_005 1793 CDS 100% 15.000 21.000 N DDX31 n/a
2 TRCN0000050372 CGGTTAGCACAAGTGATAGAA pLKO.1 706 CDS 100% 5.625 7.875 N DDX31 n/a
3 TRCN0000232436 GACGCCTGGTGGATCATATAA pLKO_005 1246 CDS 100% 15.000 12.000 N DDX31 n/a
4 TRCN0000050368 CCACAATAAATACGGTCTTAA pLKO.1 880 CDS 100% 13.200 9.240 N DDX31 n/a
5 TRCN0000232435 CCACAATAAATACGGTCTTAA pLKO_005 880 CDS 100% 13.200 9.240 N DDX31 n/a
6 TRCN0000232437 GGACATCACAGTGATACTTAA pLKO_005 1352 CDS 100% 13.200 9.240 N DDX31 n/a
7 TRCN0000050370 CCCTTCAAGCAATGGAGTCAA pLKO.1 1027 CDS 100% 4.950 3.465 N DDX31 n/a
8 TRCN0000184150 CGACACTCACAGAAGGTGTAA pLKO.1 1420 CDS 100% 4.950 3.465 N Ddx31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138620.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12496 pDONR223 100% 47.9% 47.9% None 1_531del;1755_1756ins798 n/a
2 ccsbBroad304_12496 pLX_304 0% 47.9% 47.9% V5 1_531del;1755_1756ins798 n/a
3 TRCN0000465632 GATACCCTCCTCTGCCCGTTCCAC pLX_317 18.1% 47.9% 47.9% V5 1_531del;1755_1756ins798 n/a
Download CSV