Transcript: Mouse NM_138654.3

Mus musculus succinyl-CoA glutarate-CoA transferase (Sugct), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Sugct (192136)
Length:
1727
CDS:
34..1344

Additional Resources:

NCBI RefSeq record:
NM_138654.3
NBCI Gene record:
Sugct (192136)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_138654.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114425 CTTCTGCTATGTCTGGTCTAA pLKO.1 563 CDS 100% 4.950 6.930 N Sugct n/a
2 TRCN0000114421 CCAGTCTTGATCCTACTACAA pLKO.1 1413 3UTR 100% 4.950 3.465 N Sugct n/a
3 TRCN0000114424 CGCAGTCAGATTGTGACAGTA pLKO.1 119 CDS 100% 4.950 3.465 N Sugct n/a
4 TRCN0000114423 GCAGCCATTTGTGATGTGTTT pLKO.1 394 CDS 100% 4.950 3.465 N Sugct n/a
5 TRCN0000114422 GCCACGATGAATTTAGGAGAT pLKO.1 199 CDS 100% 4.050 2.835 N Sugct n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138654.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08958 pDONR223 100% 78.8% 78% None (many diffs) n/a
2 ccsbBroad304_08958 pLX_304 0% 78.8% 78% V5 (many diffs) n/a
3 TRCN0000469305 GGGGCGAGCTCCCCTATAAGAGTT pLX_317 29.5% 78.8% 78% V5 (many diffs) n/a
Download CSV