Transcript: Mouse NM_138671.2

Mus musculus NAD kinase (Nadk), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Nadk (192185)
Length:
2952
CDS:
91..1410

Additional Resources:

NCBI RefSeq record:
NM_138671.2
NBCI Gene record:
Nadk (192185)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_138671.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221733 GCTATGCAATACCAGGTCTTA pLKO.1 907 CDS 100% 4.950 6.930 N Nadk n/a
2 TRCN0000297514 GCTATGCAATACCAGGTCTTA pLKO_005 907 CDS 100% 4.950 6.930 N Nadk n/a
3 TRCN0000221732 CCCTTCAAAGAGCTCTGCATA pLKO.1 451 CDS 100% 4.950 3.465 N Nadk n/a
4 TRCN0000221734 CCTGCTATAGTGAGTGATGAA pLKO.1 529 CDS 100% 4.950 3.465 N Nadk n/a
5 TRCN0000278616 CCTGCTATAGTGAGTGATGAA pLKO_005 529 CDS 100% 4.950 3.465 N Nadk n/a
6 TRCN0000221735 CTGGAGCTACAATCACCCTAT pLKO.1 183 CDS 100% 4.050 2.835 N Nadk n/a
7 TRCN0000278617 CTGGAGCTACAATCACCCTAT pLKO_005 183 CDS 100% 4.050 2.835 N Nadk n/a
8 TRCN0000221736 TGGACGGAAGAGACAGGAAAT pLKO.1 1227 CDS 100% 10.800 6.480 N Nadk n/a
9 TRCN0000297518 TGGACGGAAGAGACAGGAAAT pLKO_005 1227 CDS 100% 10.800 6.480 N Nadk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138671.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08892 pDONR223 100% 84.2% 90.8% None (many diffs) n/a
2 ccsbBroad304_08892 pLX_304 0% 84.2% 90.8% V5 (many diffs) n/a
3 TRCN0000471738 TACAGAGCCGCCAGAGATGGGTGG pLX_317 2.2% 84.2% 90.8% V5 (many diffs) n/a
4 ccsbBroadEn_15141 pDONR223 0% 84.2% 90.8% None (many diffs) n/a
5 ccsbBroad304_15141 pLX_304 0% 84.2% 90.8% V5 (many diffs) n/a
6 TRCN0000474095 TAATGCGGTTTCATTAGCGCGCCT pLX_317 33.7% 84.2% 90.8% V5 (many diffs) n/a
Download CSV