Transcript: Mouse NM_138748.5

Mus musculus protein phosphatase 2 protein activator (Ptpa), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ptpa (110854)
Length:
2577
CDS:
253..1224

Additional Resources:

NCBI RefSeq record:
NM_138748.5
NBCI Gene record:
Ptpa (110854)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_138748.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077223 GCCAGGAATTAACTATGGTCT pLKO.1 2382 3UTR 100% 2.640 3.696 N Ptpa n/a
2 TRCN0000301403 GCCAGGAATTAACTATGGTCT pLKO_005 2382 3UTR 100% 2.640 3.696 N Ptpa n/a
3 TRCN0000077224 GCTATTGTCTTCAAGGTGTTT pLKO.1 787 CDS 100% 4.950 3.465 N Ptpa n/a
4 TRCN0000301402 GCTATTGTCTTCAAGGTGTTT pLKO_005 787 CDS 100% 4.950 3.465 N Ptpa n/a
5 TRCN0000077225 GCACTTCTTGATACGCTGGAT pLKO.1 487 CDS 100% 2.640 1.848 N Ptpa n/a
6 TRCN0000331724 GCACTTCTTGATACGCTGGAT pLKO_005 487 CDS 100% 2.640 1.848 N Ptpa n/a
7 TRCN0000077227 CCTGTTCATCACTGAGATGAA pLKO.1 1023 CDS 100% 0.495 0.347 N Ptpa n/a
8 TRCN0000301329 CCTGTTCATCACTGAGATGAA pLKO_005 1023 CDS 100% 0.495 0.347 N Ptpa n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138748.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01265 pDONR223 100% 89.8% 96.2% None (many diffs) n/a
2 ccsbBroad304_01265 pLX_304 0% 89.8% 96.2% V5 (many diffs) n/a
3 TRCN0000468284 GACTCTCTTGCGACAAAGACAAAT pLX_317 36.1% 89.8% 96.2% V5 (many diffs) n/a
Download CSV