Transcript: Human NM_138795.4

Homo sapiens ADP ribosylation factor like GTPase 8A (ARL8A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ARL8A (127829)
Length:
1789
CDS:
166..726

Additional Resources:

NCBI RefSeq record:
NM_138795.4
NBCI Gene record:
ARL8A (127829)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138795.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072951 GTGGGTTTCAACATGCGCAAA pLKO.1 322 CDS 100% 4.050 5.670 N ARL8A n/a
2 TRCN0000233047 GTCCTGTGTGTACAGTATATA pLKO_005 1068 3UTR 100% 15.000 10.500 N ARL8A n/a
3 TRCN0000233046 CATCACCCTACAGTGGCTTAT pLKO_005 678 CDS 100% 10.800 7.560 N ARL8A n/a
4 TRCN0000233043 GACTGGTTCAAGGCCCTATTC pLKO_005 193 CDS 100% 10.800 7.560 N ARL8A n/a
5 TRCN0000233044 GAGAAGATTGAGGCCTCTAAG pLKO_005 469 CDS 100% 10.800 7.560 N ARL8A n/a
6 TRCN0000233045 TCCACAACCTACTGGACAAAC pLKO_005 497 CDS 100% 10.800 7.560 N ARL8A n/a
7 TRCN0000072950 CTCCACAACCTACTGGACAAA pLKO.1 496 CDS 100% 4.950 3.465 N ARL8A n/a
8 TRCN0000072948 GCTCATATTTAACCTCTGTTT pLKO.1 1684 3UTR 100% 4.950 3.465 N ARL8A n/a
9 TRCN0000072952 CCCGGTCTTAGTCCTGGGTAA pLKO.1 534 CDS 100% 1.350 0.945 N ARL8A n/a
10 TRCN0000072949 CCTATTCTGGAAGGAGGAGAT pLKO.1 207 CDS 100% 4.050 2.430 N ARL8A n/a
11 TRCN0000313723 AGATCTGCTGCTACTCCATAT pLKO_005 632 CDS 100% 10.800 8.640 N Arl8a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138795.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04831 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04831 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471037 AGGCGAGGTAAGTCATCTGCTATG pLX_317 72.8% 100% 100% V5 n/a
Download CSV