Transcript: Mouse NM_138953.2

Mus musculus elongation factor RNA polymerase II 2 (Ell2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Ell2 (192657)
Length:
3660
CDS:
168..2087

Additional Resources:

NCBI RefSeq record:
NM_138953.2
NBCI Gene record:
Ell2 (192657)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_138953.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336289 ACCGACATTAAATGGTTATTT pLKO_005 1199 CDS 100% 15.000 21.000 N Ell2 n/a
2 TRCN0000336224 CTTTGTCATTAGCGATGATTT pLKO_005 2390 3UTR 100% 13.200 18.480 N Ell2 n/a
3 TRCN0000203500 CCACCGACATTAAATGGTTAT pLKO.1 1197 CDS 100% 10.800 15.120 N Ell2 n/a
4 TRCN0000203090 GCCACAAGAATTTAATTCCTT pLKO.1 307 CDS 100% 3.000 4.200 N Ell2 n/a
5 TRCN0000353318 CACTTGAACTCCCAGATTATT pLKO_005 1729 CDS 100% 15.000 12.000 N Ell2 n/a
6 TRCN0000336288 AGGGACAGGGTCATCCATTTA pLKO_005 786 CDS 100% 13.200 9.240 N Ell2 n/a
7 TRCN0000017908 CCTGGGATTTATACAAGATAA pLKO.1 509 CDS 100% 13.200 9.240 N ELL2 n/a
8 TRCN0000336225 TGAGTAATGCCAGTCCAAATC pLKO_005 1657 CDS 100% 10.800 7.560 N Ell2 n/a
9 TRCN0000188411 CCAATCCTCCTCAGACTGTAA pLKO.1 1321 CDS 100% 4.950 3.465 N Ell2 n/a
10 TRCN0000017912 CCCTGCAAATACAATTCGAAA pLKO.1 728 CDS 100% 4.950 3.465 N ELL2 n/a
11 TRCN0000274359 CCCTGCAAATACAATTCGAAA pLKO_005 728 CDS 100% 4.950 3.465 N ELL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138953.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.