Transcript: Human NM_139055.3

Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif 15 (ADAMTS15), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
ADAMTS15 (170689)
Length:
5677
CDS:
1..2853

Additional Resources:

NCBI RefSeq record:
NM_139055.3
NBCI Gene record:
ADAMTS15 (170689)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_139055.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046763 GCGCGGTTACAAAGGGCTGAT pLKO.1 2139 CDS 100% 1.350 1.890 N ADAMTS15 n/a
2 TRCN0000046764 GCTGCTTCTTAGAGATCGTGA pLKO.1 807 CDS 100% 2.640 2.112 N ADAMTS15 n/a
3 TRCN0000424137 GCCCATGCATGGCTACAATTT pLKO_005 2073 CDS 100% 13.200 9.240 N ADAMTS15 n/a
4 TRCN0000425633 GCCAAGCGTTTCGTGTCTATC pLKO_005 628 CDS 100% 10.800 7.560 N ADAMTS15 n/a
5 TRCN0000412586 TGGATGGTTCCTGGGCCAAAT pLKO_005 1544 CDS 100% 10.800 7.560 N ADAMTS15 n/a
6 TRCN0000046767 ACAGCATTTCAGGAGGACTTT pLKO.1 172 CDS 100% 4.950 3.465 N ADAMTS15 n/a
7 TRCN0000046765 CTCCAAGAAGAGATTCGACAA pLKO.1 1992 CDS 100% 4.050 2.835 N ADAMTS15 n/a
8 TRCN0000046766 GCCCTGTCCTTACATGCAGTA pLKO.1 1371 CDS 100% 4.050 2.835 N ADAMTS15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_139055.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05159 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05159 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467885 CTCGTCCTAAACGAACAAAACCCT pLX_317 14.1% 100% 100% V5 n/a
Download CSV