Transcript: Mouse NM_139142.2

Mus musculus solute carrier family 6 (neurotransmitter transporter), member 20A (Slc6a20a), mRNA.

Source:
NCBI, updated 2019-09-17
Taxon:
Mus musculus (mouse)
Gene:
Slc6a20a (102680)
Length:
1894
CDS:
27..1805

Additional Resources:

NCBI RefSeq record:
NM_139142.2
NBCI Gene record:
Slc6a20a (102680)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_139142.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070183 CGATGCCTTACTGTGTTCTTA pLKO.1 628 CDS 100% 5.625 7.875 N Slc6a20a n/a
2 TRCN0000070184 GCAGTTGGTGACCAAGGATTA pLKO.1 1658 CDS 100% 10.800 8.640 N Slc6a20a n/a
3 TRCN0000070187 CCTCTCCATGTACTACAATGT pLKO.1 317 CDS 100% 4.950 3.465 N Slc6a20a n/a
4 TRCN0000070185 TGCCTCATCAACTGTGCTGTT pLKO.1 1338 CDS 100% 4.050 2.835 N Slc6a20a n/a
5 TRCN0000435926 GAACTACTGGTTTGACATATT pLKO_005 1385 CDS 100% 13.200 7.920 N SLC6A20 n/a
6 TRCN0000070186 CCCTACATCATCATGCTCATT pLKO.1 162 CDS 100% 4.950 2.475 Y Slc6a20a n/a
7 TRCN0000038354 GAGATTTGAAAGTGACCTTAA pLKO.1 1487 CDS 100% 10.800 5.400 Y SLC6A20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_139142.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08406 pDONR223 100% 87.8% 92% None (many diffs) n/a
2 ccsbBroad304_08406 pLX_304 0% 87.8% 92% V5 (many diffs) n/a
3 TRCN0000473895 TTATTGCACGAAAATGGTTAAAAG pLX_317 21.2% 87.8% 92% V5 (many diffs) n/a
Download CSV