Transcript: Mouse NM_139146.2

Mus musculus special AT-rich sequence binding protein 2 (Satb2), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Satb2 (212712)
Length:
5299
CDS:
283..2484

Additional Resources:

NCBI RefSeq record:
NM_139146.2
NBCI Gene record:
Satb2 (212712)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_139146.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085149 CGCTGAAGATCCAATTACAAA pLKO.1 734 CDS 100% 5.625 7.875 N Satb2 n/a
2 TRCN0000020684 GCCATTTATGACGAGATCCAA pLKO.1 1738 CDS 100% 3.000 2.400 N SATB2 n/a
3 TRCN0000085152 CAGGGATTATTGTCAGAGATA pLKO.1 1453 CDS 100% 4.950 3.465 N Satb2 n/a
4 TRCN0000020687 GCCTTAAAGGAACTGCTCAAA pLKO.1 814 CDS 100% 4.950 3.465 N SATB2 n/a
5 TRCN0000085151 GCGTCTCAGTCTCTTCTAGTA pLKO.1 1501 CDS 100% 4.950 3.465 N Satb2 n/a
6 TRCN0000085148 CCCACGAGATAAATGAAGGAA pLKO.1 2807 3UTR 100% 3.000 2.100 N Satb2 n/a
7 TRCN0000085150 CGCACAAAGATCTCTTTGGAA pLKO.1 2134 CDS 100% 0.300 0.210 N Satb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_139146.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02751 pDONR223 100% 92.4% 99.5% None (many diffs) n/a
2 ccsbBroad304_02751 pLX_304 0% 92.4% 99.5% V5 (many diffs) n/a
3 TRCN0000468644 GTGCTTGGTGTGTATATTGGTGTA pLX_317 17.8% 92.4% 99.5% V5 (many diffs) n/a
Download CSV