Transcript: Mouse NM_139149.2

Mus musculus fused in sarcoma (Fus), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Fus (233908)
Length:
1845
CDS:
87..1643

Additional Resources:

NCBI RefSeq record:
NM_139149.2
NBCI Gene record:
Fus (233908)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_139149.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362567 TCGACTGGTTTGATGGTAAAG pLKO_005 1117 CDS 100% 10.800 15.120 N Fus n/a
2 TRCN0000362568 TGGGAATCCTATTAAAGTTTC pLKO_005 1145 CDS 100% 10.800 15.120 N Fus n/a
3 TRCN0000362566 AGCAGCTATGGTTCTTCTTAT pLKO_005 243 CDS 100% 13.200 10.560 N Fus n/a
4 TRCN0000102296 GCGAGAATGTTACAATTGAAT pLKO.1 943 CDS 100% 5.625 4.500 N Fus n/a
5 TRCN0000225723 TCGCAGGGAGAGGCCATATTA pLKO_005 1622 CDS 100% 15.000 10.500 N Fus n/a
6 TRCN0000225721 CAACAACAAAGCTCCTATAAC pLKO_005 522 CDS 100% 13.200 9.240 N Fus n/a
7 TRCN0000102295 CCCAGTGTTACCCTTGTTATT pLKO.1 1677 3UTR 100% 13.200 9.240 N Fus n/a
8 TRCN0000225724 CCCAGTGTTACCCTTGTTATT pLKO_005 1677 3UTR 100% 13.200 9.240 N Fus n/a
9 TRCN0000218229 CTAGGCGAGAATGTTACAATT pLKO_005 939 CDS 100% 13.200 9.240 N Fus n/a
10 TRCN0000102299 CAACAGAGTTACAGTGGTTAT pLKO.1 189 CDS 100% 10.800 7.560 N Fus n/a
11 TRCN0000225722 TCAAGGATCTCGTCATGATTC pLKO_005 875 CDS 100% 10.800 7.560 N Fus n/a
12 TRCN0000102298 CCTAGGCGAGAATGTTACAAT pLKO.1 938 CDS 100% 5.625 3.938 N Fus n/a
13 TRCN0000001135 ACAGGATAATTCAGACAACAA pLKO.1 899 CDS 100% 4.950 3.465 N FUS n/a
14 TRCN0000102297 CCAACAGAGTTACAGTGGTTA pLKO.1 188 CDS 100% 4.950 3.465 N Fus n/a
15 TRCN0000221579 GCTGATTACTTCAAGCAGATT pLKO.1 969 CDS 100% 4.950 3.465 N FUS n/a
16 TRCN0000288639 GCTGATTACTTCAAGCAGATT pLKO_005 969 CDS 100% 4.950 3.465 N FUS n/a
17 TRCN0000010450 ATGAATGCAACCAGTGTAAGG pLKO.1 1390 CDS 100% 4.050 2.835 N FUS n/a
18 TRCN0000295857 ATGAATGCAACCAGTGTAAGG pLKO_005 1390 CDS 100% 4.050 2.835 N FUS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_139149.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06229 pDONR223 99.3% 87.9% 95% None (many diffs) n/a
2 ccsbBroad304_06229 pLX_304 0% 87.9% 95% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV