Transcript: Human NM_139156.3

Homo sapiens adenosine monophosphate deaminase 2 (AMPD2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
AMPD2 (271)
Length:
3785
CDS:
457..2853

Additional Resources:

NCBI RefSeq record:
NM_139156.3
NBCI Gene record:
AMPD2 (271)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_139156.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413486 GGGTATCTGGGAAGTACTTTG pLKO_005 1748 CDS 100% 10.800 15.120 N AMPD2 n/a
2 TRCN0000051795 CATCGCTTTGACAAGTTTAAT pLKO.1 1666 CDS 100% 15.000 10.500 N AMPD2 n/a
3 TRCN0000425749 TCATGCTGGCTGAGAACATTT pLKO_005 2315 CDS 100% 13.200 9.240 N AMPD2 n/a
4 TRCN0000446841 ATGTGCTGGAACGGGAGTTTC pLKO_005 851 CDS 100% 10.800 7.560 N AMPD2 n/a
5 TRCN0000051793 GCACGTCTATGGATGGCAAAT pLKO.1 560 CDS 100% 10.800 7.560 N AMPD2 n/a
6 TRCN0000119811 GCGCACGTCTATGGATGGCAA pLKO.1 558 CDS 100% 0.880 0.616 N Ampd2 n/a
7 TRCN0000326234 GCGCACGTCTATGGATGGCAA pLKO_005 558 CDS 100% 0.880 0.616 N Ampd2 n/a
8 TRCN0000051797 GCGCTTCATCAAGCGGGCAAT pLKO.1 1506 CDS 100% 0.135 0.095 N AMPD2 n/a
9 TRCN0000051794 GCCTCTTTGATGTGTACCGTA pLKO.1 1940 CDS 100% 2.640 1.584 N AMPD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_139156.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00063 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00063 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471533 AAATGCGGGGTAGAGTTCTGCGTG pLX_317 16.1% 100% 100% V5 n/a
Download CSV