Construct: ORF TRCN0000471533
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009180.1_s317c1
- Derived from:
- ccsbBroadEn_00063
- DNA Barcode:
- AAATGCGGGGTAGAGTTCTGCGTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- AMPD2 (271)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471533
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 271 | AMPD2 | adenosine monophosphate dea... | NM_139156.3 | 100% | 100% | |
| 2 | human | 271 | AMPD2 | adenosine monophosphate dea... | NM_001368809.2 | 96.6% | 96.4% | 1_70del;71_72insT;77_88del |
| 3 | human | 271 | AMPD2 | adenosine monophosphate dea... | NM_004037.9 | 96.6% | 96.4% | 1_70del;71_72insT;77_88del |
| 4 | human | 271 | AMPD2 | adenosine monophosphate dea... | NM_001308170.1 | 95.5% | 93.2% | (many diffs) |
| 5 | human | 271 | AMPD2 | adenosine monophosphate dea... | XM_024446431.1 | 95.5% | 93.2% | (many diffs) |
| 6 | human | 271 | AMPD2 | adenosine monophosphate dea... | NM_001257361.1 | 95.3% | 95.3% | 0_1ins111 |
| 7 | human | 271 | AMPD2 | adenosine monophosphate dea... | XM_024446432.1 | 85.8% | 80.9% | (many diffs) |
| 8 | human | 271 | AMPD2 | adenosine monophosphate dea... | XR_002956282.1 | 56.6% | (many diffs) | |
| 9 | mouse | 109674 | Ampd2 | adenosine monophosphate dea... | NM_001289719.1 | 90.2% | 97.4% | (many diffs) |
| 10 | mouse | 109674 | Ampd2 | adenosine monophosphate dea... | NM_028779.5 | 90.2% | 97.4% | (many diffs) |
| 11 | mouse | 109674 | Ampd2 | adenosine monophosphate dea... | NM_001346665.1 | 87.2% | 94.1% | (many diffs) |
| 12 | mouse | 109674 | Ampd2 | adenosine monophosphate dea... | XM_006500871.3 | 86.6% | 91.9% | (many diffs) |
| 13 | mouse | 109674 | Ampd2 | adenosine monophosphate dea... | NM_001289720.1 | 86.1% | 92.9% | (many diffs) |
| 14 | mouse | 109674 | Ampd2 | adenosine monophosphate dea... | XM_006500870.3 | 84.8% | 91.9% | (many diffs) |
| 15 | mouse | 109674 | Ampd2 | adenosine monophosphate dea... | XM_011239985.2 | 84.8% | 91.9% | (many diffs) |
| 16 | mouse | 109674 | Ampd2 | adenosine monophosphate dea... | XM_017319424.1 | 64.3% | 69.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2460
- ORF length:
- 2394
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ctcagaggct cggggtggtc tgggggcccc tccgctgcag tctgcccgat 121 ccctgccggg ccccgccccc tgcctcaagc acttcccgct cgacctgcgc acgtctatgg 181 atggcaaatg caaggagatc gccgaggagc tgttcacccg ctcactggct gagagcgagc 241 tccgtagtgc cccgtatgag ttccccgagg agagccccat tgaacagctg gaggagcggc 301 ggcagcggct ggagcggcag atcagccagg atgtcaagct ggagccagac atcctgcttc 361 gggccaagca agatttcctg aagacggaca gtgactcgga cctacagctc tacaaggaac 421 agggtgaggg gcagggtgac cggagcctgc gggagcgtga tgtgctggaa cgggagtttc 481 agcgggtcac catctctggg gaggagaagt gtggggtgcc gttcacagac ctgctggatg 541 cagccaagag tgtggtgcgg gcgctcttca tccgggagaa gtacatggcc ctgtccctgc 601 agagcttctg ccccaccacc cgccgctacc tgcagcagct ggctgaaaag cctctggaga 661 cccggaccta tgaacagggc cccgacaccc ctgtgtctgc tgatgccccg gtgcaccccc 721 ctgcgctgga gcagcacccg tatgagcact gtgagccaag caccatgcct ggggacctgg 781 gcttgggtct gcgcatggtg cggggtgtgg tgcacgtcta cacccgcagg gaacccgacg 841 agcattgctc agaggtggag ctgccatacc ctgacctgca ggaatttgtg gctgacgtca 901 atgtgctgat ggccctgatt atcaatggcc ccataaagtc attctgctac cgccggctgc 961 agtacctgag ctccaagttc cagatgcatg tgctactcaa tgagatgaag gagctggccg 1021 cccagaagaa agtgccacac cgagatttct acaacatccg caaggtggac acccacatcc 1081 atgcctcgtc ctgcatgaac cagaagcatc tgctgcgctt catcaagcgg gcaatgaagc 1141 ggcacctgga ggagatcgtg cacgtggagc agggccgtga acagacgctg cgggaggtct 1201 ttgagagcat gaatctcacg gcctacgacc tgagtgtgga cacgctggat gtgcatgcgg 1261 acaggaacac tttccatcgc tttgacaagt ttaatgccaa atacaaccct attggggagt 1321 ccgtcctccg agagatcttc atcaagacgg acaacagggt atctgggaag tactttgctc 1381 acatcatcaa ggaggtgatg tcagacctgg aggagagcaa ataccagaat gcagagctgc 1441 ggctctccat ttacgggcgc tcgagggatg agtgggacaa gctggcgcgc tgggccgtca 1501 tgcaccgcgt gcactccccc aacgtgcgct ggctggtgca ggtgccccgc ctctttgatg 1561 tgtaccgtac caagggccag ctggccaact tccaggagat gctggagaac atcttcctgc 1621 cactgttcga ggccactgtg caccctgcca gccacccgga actgcatctc ttcttagagc 1681 acgtggatgg ttttgacagc gtggatgatg agtccaagcc tgaaaaccat gtcttcaacc 1741 tggagagccc cctgcctgag gcgtgggtgg aggaggacaa cccaccctat gcctactacc 1801 tgtactacac ctttgccaac atggccatgt tgaaccacct gcgcaggcag aggggcttcc 1861 acacgtttgt gctgaggcca cactgtgggg aggctgggcc catccaccac ctggtgtcag 1921 ccttcatgct ggctgagaac atttcccacg ggctccttct gcgcaaggcc cccgtcctgc 1981 agtacctgta ctacctggcc cagatcggca tcgccatgtc tccgctcagc aacaacagcc 2041 tcttcctcag ctatcaccgg aatccgctac cggagtaccT GTCCCGCGGC CTCATGGTCT 2101 CCCTGTCCAC TGATGATCCC TTGCAGTTCC ACTTCACCAA GGAGCCGCTG ATGGAGGAGT 2161 ACAGCATCGC CACCCAGGTG TGGAAGCTCA GCTCCTGCGA TATGTGTGAG CTGGCCCGCA 2221 ACAGCGTGCT CATGAGCGGC TTCTCGCACA AGGTAAAGAG CCACTGGCTG GGACCCAACT 2281 ATACCAAGGA AGGCCCTGAG GGGAATGACA TCCGCCGGAC CAATGTGCCA GACATCCGCG 2341 TGGGCTACCG CTACGAGACC CTGTGCCAGG AGCTGGCGCT CATCACGCAG GCAGTCCAGA 2401 GTGAGATGCT GGAGACCATT CCAGAGGAGG CGGGTATCAC CATGAGCCCA GGGCCTCAAT 2461 GCCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 2521 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 2581 TTTATATATC TTGTGGAAAG GACGAAAATG CGGGGTAGAG TTCTGCGTGA CGCGTTAAGT 2641 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt