Transcript: Human NM_139247.4

Homo sapiens adenylate cyclase 4 (ADCY4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
ADCY4 (196883)
Length:
3405
CDS:
115..3348

Additional Resources:

NCBI RefSeq record:
NM_139247.4
NBCI Gene record:
ADCY4 (196883)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_139247.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078367 CCTACCTATCTGGTCATCGAT pLKO.1 1438 CDS 100% 3.000 4.200 N ADCY4 n/a
2 TRCN0000433661 AGGCTGCTCAATGAGATAATT pLKO_005 2812 CDS 100% 15.000 10.500 N ADCY4 n/a
3 TRCN0000427326 CCGTAGTAGCTGGAGTTATTG pLKO_005 3086 CDS 100% 13.200 9.240 N ADCY4 n/a
4 TRCN0000078365 GCCAGAGAGCACTAACAATTT pLKO.1 876 CDS 100% 13.200 9.240 N ADCY4 n/a
5 TRCN0000428226 AGCAGCTCAACTCGCAGAAAC pLKO_005 1751 CDS 100% 10.800 7.560 N ADCY4 n/a
6 TRCN0000078363 CCCGCCTTCAAATACTATGAA pLKO.1 1858 CDS 100% 5.625 3.938 N ADCY4 n/a
7 TRCN0000078364 CGTCATCAACAAGCATTCATT pLKO.1 3027 CDS 100% 5.625 3.938 N ADCY4 n/a
8 TRCN0000078366 CCTTGGCACTATGGTGGAATT pLKO.1 2979 CDS 100% 0.000 0.000 N ADCY4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_139247.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489624 GCCTTACCCTCATTAGGAGTCTGT pLX_317 9% 99.9% 99.9% V5 3231_3232insG n/a
Download CSV