Transcript: Human NM_139323.4

Homo sapiens tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta (YWHAB), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
YWHAB (7529)
Length:
3020
CDS:
186..926

Additional Resources:

NCBI RefSeq record:
NM_139323.4
NBCI Gene record:
YWHAB (7529)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_139323.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078157 CGCTGAATGAAGAGTCTTATA pLKO.1 805 CDS 100% 13.200 10.560 N YWHAB n/a
2 TRCN0000292149 CGCTGAATGAAGAGTCTTATA pLKO_005 805 CDS 100% 13.200 10.560 N YWHAB n/a
3 TRCN0000078153 CCTCCTTTCTAGCTGAACAAA pLKO.1 2676 3UTR 100% 5.625 3.938 N YWHAB n/a
4 TRCN0000292150 CCTCCTTTCTAGCTGAACAAA pLKO_005 2676 3UTR 100% 5.625 3.938 N YWHAB n/a
5 TRCN0000078154 CCAATGCTACACAACCAGAAA pLKO.1 511 CDS 100% 4.950 3.465 N YWHAB n/a
6 TRCN0000078155 GCTGAATTGGATACGCTGAAT pLKO.1 792 CDS 100% 4.950 3.465 N YWHAB n/a
7 TRCN0000307971 GCTGAATTGGATACGCTGAAT pLKO_005 792 CDS 100% 4.950 3.465 N YWHAB n/a
8 TRCN0000078156 CCCAATGCTACACAACCAGAA pLKO.1 510 CDS 100% 4.050 2.835 N YWHAB n/a
9 TRCN0000292151 CCCAATGCTACACAACCAGAA pLKO_005 510 CDS 100% 4.050 2.835 N YWHAB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_139323.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01788 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01788 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466895 AAGTCCGTTAAAACGGCACTGCAC pLX_317 42.7% 100% 100% V5 n/a
Download CSV