Transcript: Human NM_144599.5

Homo sapiens NIPA magnesium transporter 1 (NIPA1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
NIPA1 (123606)
Length:
6553
CDS:
14..1003

Additional Resources:

NCBI RefSeq record:
NM_144599.5
NBCI Gene record:
NIPA1 (123606)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_144599.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250139 CGGCGAGGTACTTCCTATTTA pLKO_005 185 CDS 100% 15.000 21.000 N NIPA1 n/a
2 TRCN0000250141 AGGCTCCGTCGTGCTGATTAT pLKO_005 406 CDS 100% 13.200 18.480 N NIPA1 n/a
3 TRCN0000258014 CTTGGTGTACCTTAGTATATT pLKO_005 3365 3UTR 100% 15.000 12.000 N NIPA1 n/a
4 TRCN0000250142 CCATCTACTACGTCGTGTTTA pLKO_005 798 CDS 100% 13.200 9.240 N NIPA1 n/a
5 TRCN0000146880 CAGGTGTTCAAAGAGTTCAAT pLKO.1 938 CDS 100% 5.625 3.938 N NIPA1 n/a
6 TRCN0000147766 GCCTTAACTTACTGAACTGAA pLKO.1 3154 3UTR 100% 4.950 3.465 N NIPA1 n/a
7 TRCN0000147590 GATTGTCCTTATACAGGTGTT pLKO.1 925 CDS 100% 4.050 2.835 N NIPA1 n/a
8 TRCN0000250140 GTGTTCAAAGAGTTCAATTTC pLKO_005 941 CDS 100% 13.200 7.920 N NIPA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144599.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04773 pDONR223 100% 77.2% 77.2% None 1_225del n/a
2 ccsbBroad304_04773 pLX_304 0% 77.2% 77.2% V5 1_225del n/a
3 TRCN0000474365 TAGACGGGCCTAACCTCCAGGAAC pLX_317 67.5% 77.2% 77.2% V5 1_225del n/a
Download CSV