Transcript: Human NM_144649.3

Homo sapiens transmembrane protein 71 (TMEM71), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
TMEM71 (137835)
Length:
2000
CDS:
144..974

Additional Resources:

NCBI RefSeq record:
NM_144649.3
NBCI Gene record:
TMEM71 (137835)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_144649.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168055 CCTCACCAATGGCTACTATAT pLKO.1 344 CDS 100% 13.200 9.240 N TMEM71 n/a
2 TRCN0000421233 GGAAGGGAGTAAGCGAGTAAT pLKO_005 1067 3UTR 100% 13.200 9.240 N TMEM71 n/a
3 TRCN0000419458 ACAGCTTCCTGTGCGACAAAG pLKO_005 376 CDS 100% 10.800 7.560 N TMEM71 n/a
4 TRCN0000429344 GGCTGCATGGAAGTATCTTTG pLKO_005 472 CDS 100% 10.800 7.560 N TMEM71 n/a
5 TRCN0000416827 TAGGAATGCCTTCGATGAATG pLKO_005 983 3UTR 100% 10.800 7.560 N TMEM71 n/a
6 TRCN0000167163 CCTGACAACTTGAATAACAAT pLKO.1 1424 3UTR 100% 5.625 3.938 N TMEM71 n/a
7 TRCN0000167060 CATTGATGATAACTGTAGCTT pLKO.1 880 CDS 100% 3.000 2.100 N TMEM71 n/a
8 TRCN0000168537 CCAGCGTTATGTATAAGGAGA pLKO.1 427 CDS 100% 2.640 1.848 N TMEM71 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144649.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04911 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04911 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466213 TTGAAGAAATGTACTAGGCACCAT pLX_317 36% 100% 100% V5 n/a
Download CSV