Transcript: Human NM_144672.4

Homo sapiens otoancorin (OTOA), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
OTOA (146183)
Length:
3878
CDS:
270..3689

Additional Resources:

NCBI RefSeq record:
NM_144672.4
NBCI Gene record:
OTOA (146183)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_144672.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435170 GGGTCAGTGCGGAACACTTAT pLKO_005 1024 CDS 100% 13.200 18.480 N OTOA n/a
2 TRCN0000118995 GTCGAGTTATACAGTGCCAAA pLKO.1 329 CDS 100% 4.050 3.240 N OTOA n/a
3 TRCN0000430709 ATCATCTTGTCTGCCAAATAC pLKO_005 1554 CDS 100% 13.200 9.240 N OTOA n/a
4 TRCN0000118993 CGAGTTATACAGTGCCAAATT pLKO.1 331 CDS 100% 13.200 9.240 N OTOA n/a
5 TRCN0000429626 ATGCACTGCTGGATCTCATAC pLKO_005 418 CDS 100% 10.800 7.560 N OTOA n/a
6 TRCN0000118996 GCCATGAAATGCCTCTTAGAA pLKO.1 630 CDS 100% 5.625 3.938 N OTOA n/a
7 TRCN0000118992 GCGTGGAAATACTGGGAAGTT pLKO.1 2088 CDS 100% 4.950 3.465 N OTOA n/a
8 TRCN0000118994 GCTCTGTTCCTGTATGAGCTT pLKO.1 1899 CDS 100% 2.640 1.848 N OTOA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144672.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09625 pDONR223 100% 99.9% 99.9% None 3074A>C n/a
2 ccsbBroad304_09625 pLX_304 0% 99.9% 99.9% V5 3074A>C n/a
3 TRCN0000465295 CAGCAGTATATACTTAGGCTTGGT pLX_317 5% 99.9% 99.9% V5 3074A>C n/a
Download CSV