Transcript: Human NM_144704.3

Homo sapiens apoptosis inducing factor mitochondria associated 3 (AIFM3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
AIFM3 (150209)
Length:
2321
CDS:
177..1994

Additional Resources:

NCBI RefSeq record:
NM_144704.3
NBCI Gene record:
AIFM3 (150209)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_144704.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438719 CACTAAAGGCGACGAGGTGAT pLKO_005 1823 CDS 100% 4.050 5.670 N AIFM3 n/a
2 TRCN0000064544 GAGAACTAAGAAGGTCGTGTT pLKO.1 1001 CDS 100% 4.050 5.670 N AIFM3 n/a
3 TRCN0000064545 AGCATGAACTACGATCCCATT pLKO.1 1854 CDS 100% 4.050 3.240 N AIFM3 n/a
4 TRCN0000064543 CGCAAAGTGAACATTCCACAT pLKO.1 1611 CDS 100% 4.050 3.240 N AIFM3 n/a
5 TRCN0000064546 GCCAAGTGTATCTCTCCAAGT pLKO.1 720 CDS 100% 4.050 3.240 N AIFM3 n/a
6 TRCN0000417792 GTGGAGAACGTGTTCACTATC pLKO_005 1107 CDS 100% 10.800 7.560 N AIFM3 n/a
7 TRCN0000437925 CCAAGACTCTGAGCTGCAAAG pLKO_005 1078 CDS 100% 6.000 4.200 N AIFM3 n/a
8 TRCN0000437126 GGTACAGCAGTAGCACCAATG pLKO_005 745 CDS 100% 6.000 4.200 N AIFM3 n/a
9 TRCN0000437789 ACCAATGTCCCAGGCGTGTTT pLKO_005 1545 CDS 100% 4.950 3.465 N AIFM3 n/a
10 TRCN0000064547 GTTTGAGAACAACCGGGTGAA pLKO.1 1325 CDS 100% 4.050 2.835 N AIFM3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144704.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05035 pDONR223 100% 98.8% 98.8% None 1757_1777del n/a
2 ccsbBroad304_05035 pLX_304 0% 98.8% 98.8% V5 1757_1777del n/a
3 TRCN0000479715 CGTACGGTCAGCTAATTACAACCC pLX_317 18.3% 98.8% 98.8% V5 1757_1777del n/a
Download CSV