Transcript: Mouse NM_144827.4

Mus musculus spermatogenesis associated 20 (Spata20), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Spata20 (217116)
Length:
2606
CDS:
25..2397

Additional Resources:

NCBI RefSeq record:
NM_144827.4
NBCI Gene record:
Spata20 (217116)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144827.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087430 CCACAAGGATTGGATGGACAA pLKO.1 2019 CDS 100% 4.050 3.240 N Spata20 n/a
2 TRCN0000087429 CGGGCCACAGTCTACATATTT pLKO.1 2311 CDS 100% 15.000 10.500 N Spata20 n/a
3 TRCN0000087428 GCACCTACTCACCATGAAATA pLKO.1 2546 3UTR 100% 13.200 9.240 N Spata20 n/a
4 TRCN0000087431 CGCTGATGTTGCTAAAGGCAT pLKO.1 1107 CDS 100% 2.640 1.848 N Spata20 n/a
5 TRCN0000087432 GTGCTACTACAGTTAGTAGTT pLKO.1 131 CDS 100% 0.495 0.347 N Spata20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144827.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12499 pDONR223 100% 79.3% 83% None (many diffs) n/a
2 ccsbBroad304_12499 pLX_304 0% 79.3% 83% V5 (many diffs) n/a
Download CSV