Transcript: Mouse NM_144860.2

Mus musculus mindbomb E3 ubiquitin protein ligase 1 (Mib1), mRNA.

Source:
NCBI, updated 2017-05-07
Taxon:
Mus musculus (mouse)
Gene:
Mib1 (225164)
Length:
3793
CDS:
681..3701

Additional Resources:

NCBI RefSeq record:
NM_144860.2
NBCI Gene record:
Mib1 (225164)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144860.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041020 GCTGACCTGAATGCTCGTAAT pLKO.1 2241 CDS 100% 10.800 15.120 N Mib1 n/a
2 TRCN0000041021 CCTTCTATGATTAGCAACGAT pLKO.1 3096 CDS 100% 3.000 4.200 N Mib1 n/a
3 TRCN0000041018 CGGATGAGTGAATGCCCAATT pLKO.1 3642 CDS 100% 10.800 8.640 N Mib1 n/a
4 TRCN0000041022 CGATGGCATGTTTGAGACTTT pLKO.1 1496 CDS 100% 4.950 3.960 N Mib1 n/a
5 TRCN0000004557 GCCGAGTACAACAGATTTATT pLKO.1 1789 CDS 100% 15.000 10.500 N MIB1 n/a
6 TRCN0000342502 GCCGAGTACAACAGATTTATT pLKO_005 1789 CDS 100% 15.000 10.500 N MIB1 n/a
7 TRCN0000041019 GCCATAAGTAAGAAACGGGAT pLKO.1 2388 CDS 100% 2.160 1.512 N Mib1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144860.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.