Transcript: Mouse NM_144875.2

Mus musculus RAB29, member RAS oncogene family (Rab29), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Rab29 (226422)
Length:
1212
CDS:
268..882

Additional Resources:

NCBI RefSeq record:
NM_144875.2
NBCI Gene record:
Rab29 (226422)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144875.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379594 GTCACCAATGCCACTACTTTC pLKO_005 535 CDS 100% 10.800 8.640 N Rab29 n/a
2 TRCN0000102731 CCATGACACGACTCTACTATA pLKO.1 482 CDS 100% 13.200 9.240 N Rab29 n/a
3 TRCN0000382381 GCTTCTGCCTGTGTTATTATG pLKO_005 508 CDS 100% 13.200 9.240 N Rab29 n/a
4 TRCN0000380987 AGGGAAGATGTGATGTCTTTG pLKO_005 799 CDS 100% 10.800 7.560 N Rab29 n/a
5 TRCN0000382056 ATCCAGGTCTCTGAGTCATTC pLKO_005 903 3UTR 100% 10.800 7.560 N Rab29 n/a
6 TRCN0000382133 CCCAAGGGAACTACATCAATC pLKO_005 824 CDS 100% 10.800 7.560 N Rab29 n/a
7 TRCN0000102730 CTCTGAGTCATTCCAATTCTT pLKO.1 911 3UTR 100% 5.625 3.938 N Rab29 n/a
8 TRCN0000102733 GACTCTACTATAGAGATGCTT pLKO.1 491 CDS 100% 3.000 2.100 N Rab29 n/a
9 TRCN0000102734 CAATGCCACTACTTTCAGCAA pLKO.1 540 CDS 100% 2.640 1.848 N Rab29 n/a
10 TRCN0000102732 GTTCAGTAAAGAGAATGGCTT pLKO.1 690 CDS 100% 2.640 1.848 N Rab29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144875.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02050 pDONR223 100% 90.5% 93.1% None (many diffs) n/a
2 ccsbBroad304_02050 pLX_304 0% 90.5% 93.1% V5 (many diffs) n/a
3 TRCN0000467837 CAGATACGCTTGTAGGTTTTACTC pLX_317 67.4% 90.5% 93.1% V5 (many diffs) n/a
Download CSV