Transcript: Mouse NM_144925.3

Mus musculus trinucleotide repeat containing 6a (Tnrc6a), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Tnrc6a (233833)
Length:
8493
CDS:
444..6134

Additional Resources:

NCBI RefSeq record:
NM_144925.3
NBCI Gene record:
Tnrc6a (233833)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144925.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254028 CTAATTACTCTGGCGACAAAT pLKO_005 1978 CDS 100% 13.200 18.480 N Tnrc6a n/a
2 TRCN0000265473 CTCCGTCTAATCGGCAATATG pLKO_005 6525 3UTR 100% 13.200 18.480 N Tnrc6a n/a
3 TRCN0000254027 GGATAAATCCATTCGTTAAAC pLKO_005 3997 CDS 100% 13.200 18.480 N Tnrc6a n/a
4 TRCN0000254029 TCATCAAATGGAGGGTTAAAT pLKO_005 1449 CDS 100% 15.000 12.000 N Tnrc6a n/a
5 TRCN0000150256 GCACTGTAAGTTCTTCATCAA pLKO.1 1435 CDS 100% 4.950 3.960 N TNRC6A n/a
6 TRCN0000254026 CCTTGTCTACGTGGGATAATT pLKO_005 5476 CDS 100% 15.000 10.500 N Tnrc6a n/a
7 TRCN0000364732 CCTTGTCTACGTGGGATAATT pLKO_005 5476 CDS 100% 15.000 10.500 N TNRC6A n/a
8 TRCN0000364712 GAATCATGCAGGCCAATATTA pLKO_005 6289 3UTR 100% 15.000 10.500 N TNRC6A n/a
9 TRCN0000147244 GCAAACATGGTGCTATTTCAA pLKO.1 4912 CDS 100% 5.625 3.938 N TNRC6A n/a
10 TRCN0000369459 GATCTGCTGTTAAGGTGTTAA pLKO_005 889 CDS 100% 13.200 7.920 N TNRC6A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144925.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11864 pDONR223 100% 8% 8.3% None (many diffs) n/a
2 ccsbBroad304_11864 pLX_304 0% 8% 8.3% V5 (many diffs) n/a
Download CSV