Transcript: Mouse NM_144945.3

Mus musculus leucine-rich repeat LGI family, member 2 (Lgi2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Lgi2 (246316)
Length:
6315
CDS:
202..1854

Additional Resources:

NCBI RefSeq record:
NM_144945.3
NBCI Gene record:
Lgi2 (246316)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144945.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216439 GAAATGAATTTCCGGAGTTAT pLKO.1 1003 CDS 100% 13.200 18.480 N Lgi2 n/a
2 TRCN0000198027 CGTTGGAACAGTAAGCAGTTT pLKO.1 1555 CDS 100% 4.950 6.930 N Lgi2 n/a
3 TRCN0000178083 GCTTTGACTATGAGTGTACCA pLKO.1 749 CDS 100% 2.640 3.696 N Lgi2 n/a
4 TRCN0000182375 GCGTTGGAACAGTAAGCAGTT pLKO.1 1554 CDS 100% 4.050 3.240 N Lgi2 n/a
5 TRCN0000198185 CCAGCTTTGACTATGAGTGTA pLKO.1 746 CDS 100% 4.950 3.465 N Lgi2 n/a
6 TRCN0000182601 GAGCTGGACCAAGTTTGTCAA pLKO.1 1137 CDS 100% 4.950 3.465 N Lgi2 n/a
7 TRCN0000200070 CCCTGAGCCTAGTAAATGGAA pLKO.1 386 CDS 100% 3.000 2.100 N Lgi2 n/a
8 TRCN0000182131 CCAGTCACTACATGAGTGGTT pLKO.1 1308 CDS 100% 2.640 1.848 N Lgi2 n/a
9 TRCN0000177840 CCTGTTCATTGAAGGGAACAA pLKO.1 531 CDS 100% 0.495 0.347 N Lgi2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144945.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08490 pDONR223 100% 81.5% 88% None (many diffs) n/a
2 ccsbBroad304_08490 pLX_304 0% 81.5% 88% V5 (many diffs) n/a
3 TRCN0000481617 CACACCCCACCATCCCGGGATTTC pLX_317 27.3% 81.5% 88% V5 (many diffs) n/a
Download CSV