Transcript: Human NM_144963.4

Homo sapiens family with sequence similarity 91 member A1 (FAM91A1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
FAM91A1 (157769)
Length:
5529
CDS:
265..2781

Additional Resources:

NCBI RefSeq record:
NM_144963.4
NBCI Gene record:
FAM91A1 (157769)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_144963.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161856 GAGAGTTCACTCGTGTCAATA pLKO.1 2144 CDS 100% 13.200 9.240 N FAM91A1 n/a
2 TRCN0000281240 GAGAGTTCACTCGTGTCAATA pLKO_005 2144 CDS 100% 13.200 9.240 N FAM91A1 n/a
3 TRCN0000159725 GCAGTCACAATGTTTGAAGTA pLKO.1 1471 CDS 100% 4.950 3.465 N FAM91A1 n/a
4 TRCN0000160644 CTGGACAGCTTTCTTATAGAA pLKO.1 1513 CDS 100% 5.625 3.375 N FAM91A1 n/a
5 TRCN0000281238 CTGGACAGCTTTCTTATAGAA pLKO_005 1513 CDS 100% 5.625 3.375 N FAM91A1 n/a
6 TRCN0000161570 GCTCAGATGTAAATGGGAGTA pLKO.1 2318 CDS 100% 4.050 2.430 N FAM91A1 n/a
7 TRCN0000281173 GCTCAGATGTAAATGGGAGTA pLKO_005 2318 CDS 100% 4.050 2.430 N FAM91A1 n/a
8 TRCN0000165329 GCACACAAATGTTGCAGAGCT pLKO.1 1056 CDS 100% 2.640 1.584 N FAM91A1 n/a
9 TRCN0000162250 CCACTCTTACTGCCTTCTTAA pLKO.1 1415 CDS 100% 13.200 6.600 Y FAM91A1 n/a
10 TRCN0000281174 CCACTCTTACTGCCTTCTTAA pLKO_005 1415 CDS 100% 13.200 6.600 Y FAM91A1 n/a
11 TRCN0000159145 GCCTTCTTAATGATGGGAAAT pLKO.1 1426 CDS 100% 10.800 5.400 Y FAM91A1 n/a
12 TRCN0000281239 GCCTTCTTAATGATGGGAAAT pLKO_005 1426 CDS 100% 10.800 5.400 Y FAM91A1 n/a
13 TRCN0000160575 CCGAATTAAACCGGAAAGTTT pLKO.1 2465 CDS 100% 5.625 2.813 Y FAM91A1 n/a
14 TRCN0000160963 GCTTGCAAATGTCCTTGAGAT pLKO.1 1074 CDS 100% 4.950 2.475 Y FAM91A1 n/a
15 TRCN0000161969 GAGATTGACTTATCCCTGGTT pLKO.1 1090 CDS 100% 2.640 1.320 Y FAM91A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144963.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.